year 17, Issue 5 (September - October 2023)                   Iran J Med Microbiol 2023, 17(5): 550-558 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Javadi Z, Ownagh A. Molecular diagnosis of Coxiella burnetii in milk based on Plasmid and Transposon Genes. Iran J Med Microbiol 2023; 17 (5) :550-558
URL: http://ijmm.ir/article-1-2023-en.html
1- Department of Microbiology, Faculty of Veterinary Medicine, Urmia University, Urmia, West Azerbaijan, Iran
2- Department of Microbiology, Faculty of Veterinary Medicine, Urmia University, Urmia, West Azerbaijan, Iran , a.ownagh@urmia.ac.ir
Full-Text [PDF 888 kb]   (840 Downloads)     |   Abstract (HTML)  (1870 Views)
Full-Text:   (610 Views)
Introduction


Coxiella burnetii is a gram-negative intracellular bacterium that causes Q fever. Moreover, it is widely distributed as a zoonosis disease (1). This etiological agent is known as an important micro-organism in causing infection in human beings and animals (2). Clinical finding of Q fever is asymptomatic, but in acute form, it can cause self-limiting febrile illness, pneumonia, or hepatitis. In chronic form, the main sign is endocarditis in patients with previous valvulopathy (3). C. burnetii have integrated sequences and plasmids (4). These sequences involve the surveillance of C. burnetii and also help in designing new vaccines for preventing and controlling Q fever (5).
The IS1111 -insertion sequence, coding for a transposase, is seen in up to 56 copies in C. burnetii genomes. Consequently, this element is often used as a specific target providing sensitive diagnostic PCRs (6). In 2007, Denison et al. established a genotyping system based on four of these insertion sequence regions, which were analyzed by PCR, using an antisense primer binding inside of the IS1111 -elements in combination with an upstream sense primer specific for each element (7). The algorithm proposed by Denison et al. allowed a classification into genomic groups I–V, according to the six clusters derived by different authors described above using plasmid profiles, PCR, or restriction-endonuclease digested DNA. One advantage of this method is its ease of performing inside and between laboratories when comparing up to five different PCR results embedded in the above-mentioned decision tree (8).
Coxiella burnetii strains normally possess one of four autonomously replicating plasmids termed QpH1, QpRs, QpDV, and QpDG, or a chromosomally integrated QpH1-like plasmid. QpH1 plasmids are closely related and likely identical to QpDG (9).
All C. burnetii isolates examined to date maintain a related autonomously replicating plasmid or have chromosomally integrated plasmid-like sequences (IPS). Nucleotide sequences have been determined for QpH1, QpRS, QpDG, QpDV, and IPS of the G and S isolates (4).
Five different plasmid types of C. burnetii including: four plasmids (QpH1, QpRS, QpDV, and QpDG) and one type of QpRS-like chromosomally integrated sequence (9). The plasmids range from 32 to 54-kb in size and share a 25-kb core region (10). According to these plasmid types, there are five associated genomic groups (5). the genomic group-specific virulence was examined in mice and guinea pigs by experimental studies (11, 12). According to the studies on C. burnetii mostly from Europe and North America, this bacterium is considered to have a clonal population structure with low genetic diversity. Further research on C. burnetii isolates has a considerable impact on investigating global genetic diversity (particularly from different eras) (13).
The effectors play an important role in C. burnetii's pathogenicity. However, regarding the plasmid effectors, reports on their mutants are scarce. By using transposon mutagenesis, eight mutants of QpH1 genes and strong phenotypes were observed. Martinez, Cantet (13).
  Detection of the C. burnetii using PCR amplification of chromosomal IS1111 repetitive elements has revealed the extent to which zoonotic reservoirs have dispersed C. burnetii into the USA, with 23.8% of over 1600 random environmental samples containing C. burnetii DNA [7]. Q fever outbreaks can have a substantial financial impact as illustrated by the 2007–2011 Netherlands outbreak (>4000 cases) where human disease burden and infection control measures were estimated to cost 307 million Euro (14). This study aimed to analyze the phylogeny of isolated C. burnetii isolates based on plasmid genes in milk samples (cow, sheep, goat, and buffalo) using the nested PCR method.


 

Materials and Methods

Sampling
Four hundred milk samples were collected randomly. The number of samples based on the type of livestock, geographic region, and seasons is given in Table 1. Also, the number of herds of cows, sheep, goats, and buffaloes was 10 each. The collected milk samples were placed on ice and immediately transferred to the microbiology laboratory at the Faculty of Veterinary Medicine.
DNA extraction
Ten ml of each milk sample was centrifuged at 2191g, and then the precipitate obtained from rinsing with DEPC water was used for DNA extraction with the Blood Genomic DNA Extraction Mini Kit (50 preps) (Favorgen, Taiwan). Furthermore, all extracted samples were examined with NanoDrop 2000c (Termo Scientific, USA) to investigate the quality and concentration of DNA.
Touchdown and Nested PCR
Used Primers
  The primers used for amplifying the IS1111 gene were used according to a method by Khademi and Ownagh (18). Furthermore, Zhang and Hotta (19) utilized a method to amplify plasmid genes in this study. Table (1) presents the sequence of primers, temperature programs, and cycles.


Table 1. The amplification protocol names, thermal program for both touchdown and Trans PCR and primer names and sequences and the size of PCR products

Reference PCR condition (Cycle) PCR product size (bp) Sequence
5'----3'
Primer Name Protocol
(13, 15)
95c for 3m, 94 c for 30s, 62-66 (5) for 30s, 72c for 1m, 72c for 10m. (35) 687 TATGTATCCACCGTAGCCAGTC Trans 1 Trans-PCR
CCCAACAACACCTCCTTATTC Trans 2
95c for 3m, 94 c for 30s, 54 for 20s, 72c for 1m, 72c for 10m. (35) 203 GAGCGAACCATTGGTATCG 261F nested-PCR
CTTTAACAGCGCTTGAACGT 463R
(14) 94 for 4m, 94 for2m, 53 for1m, 72 for2m, 72/5. (35) 977 ATAATGAGATTAGAACAACCAAGA CB5 PCR
TCTTTCTTGTTCATTTTCTGAGTC CB6
This study 94 for3m, 94 for45s, 50 for45s, 72 for45s, 72 for5m. (35) 602 CTCGCTGACGGAAGAGGATCTTTT QpH1-F nested-PCR
TAACACTGCCCGTCGCTTTACT QpH1-R
(14, 16) 94 for4m, 94 for1m, 54 for1m, 72 for2m, 72 for7m. (36) 693 CTCGTACCCAAAGACTATGAATATATCC QpRS1 PCR
AACACCGATCAATGCGACTAGCCC QpRS2
94 for 3m, 94 for 30s, 51 for 20s, 72 for 90s, 72 for7m. (35) 309 ACTTTACGTCGTTTAATTCGC QpRS3 nested-PCR
CACATTGGGTATCGTACTGTCCCT QpRS4
(17) 95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) 513 TGAAGCGGCGATTAAGCTAT QpDG1 PCR
GATGGCGGTGAGTACGGTTTT QpDG2
95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) 265 GGTTGCGCTATTTGAAGAGG QpDG3 Nested-PCR
ATGTCCTTCTGCCACGACTT QpDG4
(17) 95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) 548 TTCCGCTACGTTTTTCAAGG QpDV1 PCR
CCAAGGTTTGGAAAAGCAAA QpDV2
95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) 288 ACTATCGTTCCCTGCCCTCT QpDV3 Nested-PCR
AGCCACCGGTAAATACACGA QpDV4

Electrophoresis
Detection of PCR Products

Gel electrophoresis examined the PCR products using concentrations of 1 to 2.5 of agarose gel, and the device (Syngene Bio Imaging, UK) visualized the results.
Sequencing
The PCR products of twenty C. burnetti isolates, with the amplified fragment of C. burnetii IS1111 (n=4), QpH1 (n=4), QpRS (n=4), QpDV (n=4) and QpDG (n=4) genes for twenty samples, were sent to SinaClon Company (Tehran, Iran) for sequencing. Obtained nucleotide sequences were searched against GenBank (National Centre for Biotechnology Information, Rockville Pike, and Bethesda, USA) using the advanced BLAST similarity search option and compared to the same sequences of C. burnetii isolates from GenBank. Nucleotide sequences were aligned and compared to other nucleotide sequences from GenBank using Clustal W and the phylogenetic tree was generated using the neighbor-joining method in MEGA software version X.
Statistical Analysis
Data were analyzed using the Chi-square test in SPSS version 22 (IBM Corp. Armonk, NY, USA). Differences with a p-value <0.05 were considered significant.

 
 

Results

  Specificity and Sensitivity of the Nested PCR Assays
The primers IS1111 gene and QpH1F-QpH1R amplified expected products of 203 bp and 606 bp, respectively, in the second PCRs from the Nine Mile a strain containing the QpH1 plasmid (Figure 1, 2). The primers QpRS3-QpRS4, QpDV3-QpDV4, and QpDG3-QpDG4 also yielded predicted products of 309, 288, and 265 bp in the second PCRs containing QpRS,QpDV and QpDG plasmids respectively (Figure 3, 4 and 5) .
Identification of C. burnetii Plasmids in Milk
The usefulness of the nested PCR was first evaluated for the direct identification of C. burnetii plasmids in animal milk. Initially, all of the samples were PCR-positive when primers IS1111 were used. The genomic and plasmid sequences were detected in 62 (15.5%), (95% CI: 12.3%–19.4%) of the samples.  In addition, the plasmid types of C. burnetii were directly identified in the milk by the nested PCR with primers targeted to the QpH1 and QpRS, QpDV, and QpDG plasmids. Among the 62 milk samples tested, 16 (25.8%), (95% CI: 16.6%–37.9%) were positive for the QpH1 plasmid, 5 (8%), (95% CI: 3.5%–17.5%) were positive for the QpRS plasmid were plasmids, respectively (Table 2).  In addition, the contamination rate based on QpDV 5 (11.3%), (95% CI: 3.5%–17.5%) and QpDG plasmid genes was 6 (9.7%) and 7 (11.3%), (95% CI: 5.6%–21.5%), respectively. Out of 62 positive samples, 28 (45.1%) samples had no plasmid.

Table 2. The prevalence of Coxiella burnetiid DNA in milk samples based on the animal, season, and geographical regions
Animal Total
Buffalo Cattle Sheep Goat
Age group (Years old)
< 4 2/33 (6%) 1/30 (3.3%) 0/35 (0%) 3/40 (7.5%) 6/138 (4.3%)
5-10 5/32 (15.6%) 6/30 (20%) 2/30 (6.6%) 4/31 (12.9%) 17/123 (13.8%)
>10 8/35 (22.9%) 15/40 (37.5%) 4/35 (11.4%) 7/29 (24.1%) 34/139 (24.5%)
Season
Spring 4/25 (16%) 3/25 (12%) 1/25 (4%) 4/25 (16%) 12/100 (12%)
Summer 8/25 (32%) 11/25 (44%) 3/25 (12%) 6/25 (24%) 28/100 (28%)
Autumn 3/25 (12%) 6/25 (24%) 1/25 (4%) 3/25 (12%) 13/100 (13%)
Winter 0/25 (0%) 2/25 (8%) 1/25 (4%) 1/25 (4%) 4/100 (4%)
Region
North 8/33 (24.2%) 10/29 (34.5%) 3/30 (10%) 6/28 (21.4%) 27/120 (22.5%)
Center 1/30 (3.3%) 8/39 (20.5%) 2/34 (5.9%) 5/31 (16.1%) 16/134 (11.9%)
South 6/37 (16.2%) 4/32 (12.5%) 1/36 (2.8% 3/41 (7.3%) 14/146 (9.6%)

Table 3. The rate of positive samples based on C. burnetii plasmids
Plasmid Animal Total
Buffalo Cattle Sheep Goat
QpH1 5 7 4 - 16 (25.8%)
QpRS - - - 5 5 (8%)
QpDV 2 1 1 1 5 (8%)
QpDG 2 2 2 1 7 (11.3%)
 
Figure 1. Agarose gel electrophoresis of amplified fragment of C. burnetii IS1111 gene (203 bp) using nested-PCR. ; Lane 1; 50-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 2, positive control; lanes 3, negative samples for C. burnetiidLane 4 and 7, Positive sample. Figure 2. Agarose gel electrophoresis of amplified fragment of C. burnetii QpH1 gene (606 bp) by using nested-PCR. lanes 2, 3 and 5; positive samples for C. burnetii,  Lane 6, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 7, Positive control;  Lane 8, negative control
Figure 1. Agarose gel electrophoresis of amplified fragment of C. burnetii IS1111 gene (203 bp) using nested-PCR. ; Lane 1; 50-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 2, positive control; lanes 3, negative samples for C. burnetiidLane 4 and 7, Positive sample. Figure 2. Agarose gel electrophoresis of amplified fragment of C. burnetii QpH1 gene (606 bp) by using nested-PCR. lanes 2, 3 and 5; positive samples for C. burnetii,  Lane 6, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 7, Positive control;  Lane 8, negative control
Figure 3. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpRS gene (309 bp) using nested-PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 2, Positive control (Nine Mile strain), lanes 3, 4, 5, and 6; positive samples for C. burnetii,  Lane 7, negative control. Figure 4. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpDV gene (288 bp) using nested PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lanes 2, 4, 5  positive samples for C. burnetii, Lane 6, negative control.
Figure 3. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpRS gene (309 bp) using nested-PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 2, Positive control (Nine Mile strain), lanes 3, 4, 5, and 6; positive samples for C. burnetii,  Lane 7, negative control. Figure 4. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpDV gene (288 bp) using nested PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lanes 2, 4, 5  positive samples for C. burnetii, Lane 6, negative control.

Figure 5. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpDG gene (265 bp) using nested PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lanes 2, 3, 4 positive samples for C. burnetii, Lane 5, negative control. 

Figure 5. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpDG gene (265 bp) using nested PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lanes 2, 3, 4 positive samples for C. burnetii, Lane 5, negative control.


Phylogenetic Analysis
A phylogenetic tree constructed based on neighbor-joining analysis of QpH1 and QpDG partial gene revealed that twenty isolates were closely clustered together showing 99.9% similarity that can be considered identical. QpRS, QpDV, and QpDG gene sequences are registered as accession numbers in the NCBI. Considering the 100% similarity between QpDG and QpH1 genes in different sources and regions, there was no need to plot a phylogenetic tree (Figures 6 and 7). The submitted genes with accession numbers are as follows: (QpDV; OP677863, OP712504, QpDG; OP712505, QpRS; OP718633).

Figure 6. Phylogeny tree based on QpDV gene
Figure 6. Phylogeny tree based on QpDV gene

Figure 7. Phylogeny tree based on QpRS gene
Figure 7. Phylogeny tree based on QpRS gene

 

 

 

 

Discussion

Coxiella burnetii was detected in a proportion of available raw milk, confirming that individuals who purchase and drink raw milk in Iran may be exposed to this pathogen. Coxiella burnetii strains carry one of four large, conserved, autonomously replicating plasmids (QpH1, QpRS, QpDV, or QpDG) and a QpRS-like chromosomally integrated sequence of unknown function. All C. burnetii strains have one of the four different types of plasmids or one plasmid-like chromosomally integrated sequence. The plasmids’ role in C. burnetii biology has been implicated by identifying type IV secretion effectors among its genes (4, 20).
The QpH1 plasmid, first isolated from a tick, has been regularly found in isolates obtained from cattle, sheep, and goats (9). Several serological and Molecular studies have suggested that Q fever is distributed widely in Iran (15, 16, 18). In the present study, the QpH1, QpRS, QpDV, and QpDG specific sequences were detected in 16, 5, 5, and 7 samples with Q fever, respectively. This result indicates that different strains of C. burnetii have spread in cattle, goat, sheep, and buffalo milk in Iran. We also demonstrated that only 5 isolates originating from goats possessed the QpRS plasmid.
These data suggest that C. burnetii strains possessing the QpH1 plasmid are the most prevalent strain in Iran. Samuel et al. (6, 10) demonstrated that the isolates originating from patients with acute Q fever contained the QpH1 plasmid, while the isolates originating from patients with chronic Q fever possessed the QpRS plasmid or plasmid sequences integrated into the chromosome. However, because Q fever is still not diagnosed routinely in Iran, we have been unable to obtain detailed clinical data for these animals.
A study showed that fetal morbidity may be linked to the genotype of the infecting strain, as the plasmid QpDV was more common in isolates associated with abortions (21). As already reported in the literature (16), we found that the clinical manifestations of Q fever depended, at least in part, on the C. burnetii genotype, with strains carrying the QpDV plasmid being more frequently associated with acute Q fever (21). In addition, C. burnetii isolates associated with the QpH1 plasmid have been shown to have fewer deleted genes than the isolates harboring the QpRS and QpDV plasmids (21-27). Finally, the QpDV plasmid harbors sequence coding for four proteins not found in QpH1, which could explain the differences in clinical expression. However, as the plasmid type is associated with the genetic chromosome content (21), only the ongoing pangenome analysis of C. burnetii will determine the comprehensive genomic basis for the difference in virulence between strains.
The present findings were consistent with similar studies in Iran and other countries. Based on the findings of prevalence reported by many researchers, C. burnetii is more prevalent in cow's milk compared to the milk of other animals. The reason for the high prevalence of C. burnetii in cow's milk than in other animals, such as sheep is related to the fact that the vaginal discharge of C. burnetii is commonly very short in cows (less than 14 days), while it is discharged in milk. It persists for much longer periods, and the bacterium is mainly excreted via feces and vaginal mucosa in sheep (28, 29). Therefore, cow's milk can play an important role in the epidemiology of Q fever and greatly affects public health.
  It was found that there was a significant relationship between age and discharge of C. burnetii in cow's milk. The finding was consistent with previous reports, indicating that age was a significant risk factor for the discharge of C. burnetii in cow's milk with a positive odds ratio of 1.67 times higher for each year of age (30). This study's results indicated that there was significant regional diversity in the discharge of Q fever agents in raw milk. C. burnetii was the highest milk contamination in the province's south.  It was reported that the regional distribution of Q fever in human cases was similar to the distribution and population density of sheep and cows. Therefore, it can be assumed that the population of buffaloes, cows, and sheep, which discharged the bacterium, increased the positive samples (31).
Van der Hoek et al. and Khademi et al. reported a seasonal pattern of the onset of Q fever in humans in spring and early summer (18, 32). It was found that the increase in the incidence of Q fever in animals was related to the lambing season, in other words, the highest number of cases was reported during the summer in terms of spring lambing season in many European countries. The highest prevalence of C. burnetii discharge in milk was in summer, and the result was consistent with previous reports (5, 24).
If available, information on locally circulating strains may assist physicians in developing patient management strategies. The presented findings demonstrate QpDG and QpH1 to be closely related and likely identical. Consequently, there is no need to further sequence C. burnetii plasmids at this time. Experiments carried out to analyze the function, especially of the conserved and unique plasmid regions, seem to be more important for the understanding of C. burnetii biology. All C. burnetii isolates contained plasmids or plasmid-homologous sequences integrated into the chromosome, suggesting that these sequences harbor essential factors and/or perform essential functions for the organism. Mutagenesis and transformation experiments may uncover the underlying functions of the conserved and unique genes.


 

Conclusion

The obtained results showed that the raw milk of buffalo, cow, goat, and sheep could be important sources of Q fever. Age can be considered an important risk factor in the prevalence of C. burnetii in raw milk. C. burnetii discharge in milk follows a seasonal and regional pattern. The buffalo could play an important role in the epidemiology of Q fever in West Azerbaijan; hence, it should be considered in terms of public health. This study's results indicated that nested PCR assays were useful for directly typing C. burnetii plasmids in animal milk. Plasmid typing by PCR seems to be a more promising and useful method for applying as a golden standard method to detect the microorganism and so, rapid differentiation of C. burnetii in clinical samples owing to its sensitivity and specificity. Therefore, there is a need for more studies to validate nested PCR methods for early differentiation of acute Q fever from chronic Q fever.

 

Acknowledgment

This study has been carried out with the unhesitating support of the research assistant of the Faculty of Veterinary Medicine of Urmia University, supervisors, and respected officials of the Central Laboratory and Bacteriology Laboratory of the Veterinary Faculty. We hereby express our gratitude to all these dear ones.

 

Conflicts of Interest

This manuscript has not been published and is not under consideration for publication elsewhere. We have no conflicts of interest to disclose.


 

Funding

The authors would like to thank the dean of research and technology at Urmia University for funding the Ph.D. project.

 

 

Type of Study: Original Research Article | Subject: Zoonoses Research
Received: 2023/04/25 | Accepted: 2023/08/17 | ePublished: 2023/11/29

References
1. Ullah Q, Jamil T, Saqib M, Iqbal M, Neubauer H. Q Fever-A Neglected Zoonosis. Microorganisms. 2022;10(8):1530. [DOI:10.3390/microorganisms10081530] [PMID] [PMCID]
2. Fullerton Marissa S, Colonne Punsiri M, Dragan Amanda L, Brann Katelynn R, Kurten Richard C, Voth Daniel E. Neurotransmitter System-Targeting Drugs Antagonize Growth of the Q Fever Agent, Coxiella burnetii, in Human Cells. mSphere. 2021;6(4):e0044221. [DOI:10.1128/mSphere.00442-21] [PMID] [PMCID]
3. Anderson A, Bijlmer H, Fournier P-E, Graves S, Hartzell J, Kersh GJ, et al. Diagnosis and management of Q fever-United States, 2013: recommendations from CDC and the Q Fever Working Group. MMWR Recomm Rep. 2013;62(3):1-29.
4. Voth DE, Beare PA, Howe D, Sharma UM, Samoilis G, Cockrell DC, et al. The Coxiella burnetii cryptic plasmid is enriched in genes encoding type IV secretion system substrates. J Bacteriol. 2011;193(7):1493-503. [DOI:10.1128/JB.01359-10] [PMID] [PMCID]
5. Luo S, Lu S, Fan H, Chen Z, Sun Z, Hu Y, et al. The Coxiella burnetii QpH1 plasmid is a virulence factor for colonizing bone marrow-derived murine macrophages. J Bacteriol. 2021;203(9):e00588-20. [DOI:10.1128/JB.00588-20] [PMID] [PMCID]
6. Toman R, Heinzen RA, Samuel JE, Mege J-L. Coxiella burnetii: Recent Advances and New Perspectives in Research of the Q Fever Bacterium: Springer Publishing Company, Incorporated; 2014.
7. Denison AM, Thompson HA, Massung RF. IS1111 insertion sequences of Coxiella burnetii: characterization and use for repetitive element PCR-based differentiation of Coxiella burnetii isolates. BMC Microbiol. 2007;7(1):91. [DOI:10.1186/1471-2180-7-91] [PMID] [PMCID]
8. Hanczaruk M, Meyer H, Frangoulidis D, editors. A genotyping system for Coxiella burnetii based on IS1111-elements2015: ELSEVIER GMBH, URBAN & FISCHER VERLAG OFFICE JENA, PO BOX 100537, 07705 JENA.
9. Sobotta K, Hillarius K, Jimenez PH, Kerner K, Heydel C, Menge C. Interaction of Coxiella burnetii strains of different sources and genotypes with bovine and human monocyte-derived macrophages. Front Cell Infect Microbiol. 2018;7:543. [DOI:10.3389/fcimb.2017.00543] [PMID] [PMCID]
10. Beare PA, Samuel JE, Howe D, Virtaneva K, Porcella SF, Heinzen RA. Genetic diversity of the Q fever agent, Coxiella burnetii, assessed by microarray-based whole-genome comparisons. J Bacteriol. 2006;188(7):2309-24. [DOI:10.1128/JB.188.7.2309-2324.2006] [PMID] [PMCID]
11. Long CM, Beare PA, Cockrell DC, Larson CL, Heinzen RA. Comparative virulence of diverse Coxiella burnetii strains. Virulence. 2019;10(1):133-50. [DOI:10.1080/21505594.2019.1575715] [PMID] [PMCID]
12. Russell-Lodrigue K, Andoh M, Poels M, Shive H, Weeks B, Zhang G, et al. Coxiella burnetii isolates cause genogroup-specific virulence in mouse and guinea pig models of acute Q fever. Infect Immun. 2009;77(12):5640-50. [DOI:10.1128/IAI.00851-09] [PMID] [PMCID]
13. Martinez E, Cantet F, Fava L, Norville I, Bonazzi M. Identification of OmpA, a Coxiella burnetii protein involved in host cell invasion, by multi-phenotypic high-content screening. PLoS Pathog. 2014;10(3):e1004013. [DOI:10.1371/journal.ppat.1004013] [PMID] [PMCID]
14. Kampschreur LM, Delsing CE, Groenwold RH, Wegdam-Blans MC, Bleeker-Rovers CP, de Jager-Leclercq MG, et al. Chronic Q fever in the Netherlands 5 years after the start of the Q fever epidemic: results from the Dutch chronic Q fever database. J Clin Microbiol. 2014;52(5):1637-43. [DOI:10.1128/JCM.03221-13] [PMID] [PMCID]
15. Khademi P, Ownagh A, Ataei B, Kazemnia A, Enferadi A, Khalili M, et al. Prevalence of C. burnetii DNA in sheep and goats milk in the northwest of Iran. Int J Food Microbiol. 2020;331:108716. [DOI:10.1016/j.ijfoodmicro.2020.108716] [PMID]
16. Khademi P, Ownagh A, Ataei B, Kazemnia A, Eydi J, Khalili M, et al. Molecular detection of Coxiella burnetii in horse sera in Iran. Comp Immunol Microbiol Infect Dis. 2020;72:101521. [DOI:10.1016/j.cimid.2020.101521] [PMID] [PMCID]
17. Berri M, Laroucau K, Rodolakis A. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol. 2000;72(3):285-93. [DOI:10.1016/S0378-1135(99)00178-9] [PMID]
18. Khademi P, Ownagh A, Mardani K, Khalili M. Prevalence of Coxiella burnetii in milk collected from buffalo (water buffalo) and cattle dairy farms in Northwest of Iran. Comp Immunol Microbiol Infect Dis. 2019;67:101368. [DOI:10.1016/j.cimid.2019.101368] [PMID]
19. Zhang GQ, Hotta A, Mizutani M, Ho T, Yamaguchi T, Fukushi H, et al. Direct identification of Coxiella burnetii plasmids in human sera by nested PCR. J Clin Microbiol. 1998;36(8):2210-3. [DOI:10.1128/JCM.36.8.2210-2213.1998] [PMID] [PMCID]
20. Maturana P, Graham JG, Sharma UM, Voth DE. Refining the plasmid-encoded type IV secretion system substrate repertoire of Coxiella burnetii. J Bacteriol. 2013;195(14):3269-76. [DOI:10.1128/JB.00180-13] [PMID] [PMCID]
21. Angelakis E, Million M, D'amato F, Rouli L, Richet H, Stein A, et al. Q fever and pregnancy: disease, prevention, and strain specificity. Eur J Clin Microbiol Infect Dis. 2013;32(3):361-8. [DOI:10.1007/s10096-012-1750-3] [PMID]
22. Angelakis E, Mediannikov O, Socolovschi C, Mouffok N, Bassene H, Tall A, et al. Coxiella burnetii-positive PCR in febrile patients in rural and urban Africa. Int J Infect Dis. 2014;28:107-10. [DOI:10.1016/j.ijid.2014.05.029] [PMID]
23. Mediannikov O, Fenollar F, Socolovschi C, Diatta G, Bassene H, Molez J-F, et al. Coxiella burnetii in humans and ticks in rural Senegal. PLOS Negl Trop Dis. 2010;4(4):e654. [DOI:10.1371/journal.pntd.0000654] [PMID] [PMCID]
24. Sulyok KM, Hornok S, Abichu G, Erdelyi K, Gyuranecz M. Identification of novel Coxiella burnetii genotypes from Ethiopian ticks. PLoS One. 2014;9(11):e113213. [DOI:10.1371/journal.pone.0113213] [PMID] [PMCID]
25. Davoust B, Marié J-L, de Santi VP, Berenger J-M, Edouard S, Raoult D. Three-toed sloth as putative reservoir of Coxiella burnetii, Cayenne, French Guiana. Emerg Infect Dis. 2014;20(10):1760. [DOI:10.3201/eid2010.140694] [PMID] [PMCID]
26. Sulyok KM, Kreizinger Z, Hornstra HM, Pearson T, Szigeti A, Dán Á, et al. Genotyping of Coxiella burnetiifrom domestic ruminants and human in Hungary: indication of various genotypes. BMC Vet Res. 2014;10(1):1-6. [DOI:10.1186/1746-6148-10-107] [PMID] [PMCID]
27. Gyuranecz M, Sulyok KM, Balla E, Mag T, Balazs A, Simor Z, et al. Q fever epidemic in Hungary, April to July 2013. Eurosurveillance. 2014;19(30):20863. [DOI:10.2807/1560-7917.ES2014.19.30.20863] [PMID]
28. Álvarez-Alonso R, Zendoia II, Barandika JF, Jado I, Hurtado A, López CM, et al. Monitoring Coxiella burnetii infection in naturally infected dairy sheep flocks throughout four lambing seasons and investigation of viable bacteria. Front Vet Sci. 2020;7:352. [DOI:10.3389/fvets.2020.00352] [PMID] [PMCID]
29. Plummer PJ, McClure JT, Menzies P, Morley PS, Van den Brom R, Van Metre DC. Management of C oxiella burnetii infection in livestock populations and the associated zoonotic risk: A consensus statement. J Vet Intern Med. 2018;32(5):1481-94. [DOI:10.1111/jvim.15229] [PMID] [PMCID]
30. Esmaeili S, Mobarez AM, Khalili M, Mostafavi E. High prevalence and risk factors of Coxiella burnetii in milk of dairy animals with a history of abortion in Iran. Comp Immunol Microbiol Infect Dis. 2019;63:127-30. [DOI:10.1016/j.cimid.2019.01.015] [PMID]
31. Halsby KD, Kirkbride H, Walsh AL, Okereke E, Brooks T, Donati M, et al. The epidemiology of Q fever in England and Wales 2000-2015. Vet Sci. 2017;4(28):2-7. [DOI:10.3390/vetsci4020028] [PMID] [PMCID]
32. van der Hoek W, Hunink J, Vellema P, Droogers P. Q fever in The Netherlands: the role of local environmental conditions. Int J Environ Res Public Health. 2011;21(6):441-51. [DOI:10.1080/09603123.2011.574270] [PMID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc