Coxiella burnetii is a gram-negative intracellular bacterium that causes Q fever. Moreover, it is widely distributed as a zoonosis disease (1). This etiological agent is known as an important micro-organism in causing infection in human beings and animals (2). Clinical finding of Q fever is asymptomatic, but in acute form, it can cause self-limiting febrile illness, pneumonia, or hepatitis. In chronic form, the main sign is endocarditis in patients with previous valvulopathy (3). C. burnetii have integrated sequences and plasmids (4). These sequences involve the surveillance of C. burnetii and also help in designing new vaccines for preventing and controlling Q fever (5).
The IS1111 -insertion sequence, coding for a transposase, is seen in up to 56 copies in C. burnetii genomes. Consequently, this element is often used as a specific target providing sensitive diagnostic PCRs (6). In 2007, Denison et al. established a genotyping system based on four of these insertion sequence regions, which were analyzed by PCR, using an antisense primer binding inside of the IS1111 -elements in combination with an upstream sense primer specific for each element (7). The algorithm proposed by Denison et al. allowed a classification into genomic groups I–V, according to the six clusters derived by different authors described above using plasmid profiles, PCR, or restriction-endonuclease digested DNA. One advantage of this method is its ease of performing inside and between laboratories when comparing up to five different PCR results embedded in the above-mentioned decision tree (8).
Coxiella burnetii strains normally possess one of four autonomously replicating plasmids termed QpH1, QpRs, QpDV, and QpDG, or a chromosomally integrated QpH1-like plasmid. QpH1 plasmids are closely related and likely identical to QpDG (9).
All C. burnetii isolates examined to date maintain a related autonomously replicating plasmid or have chromosomally integrated plasmid-like sequences (IPS). Nucleotide sequences have been determined for QpH1, QpRS, QpDG, QpDV, and IPS of the G and S isolates (4).
Five different plasmid types of C. burnetii including: four plasmids (QpH1, QpRS, QpDV, and QpDG) and one type of QpRS-like chromosomally integrated sequence (9). The plasmids range from 32 to 54-kb in size and share a 25-kb core region (10). According to these plasmid types, there are five associated genomic groups (5). the genomic group-specific virulence was examined in mice and guinea pigs by experimental studies (11, 12). According to the studies on C. burnetii mostly from Europe and North America, this bacterium is considered to have a clonal population structure with low genetic diversity. Further research on C. burnetii isolates has a considerable impact on investigating global genetic diversity (particularly from different eras) (13).
The effectors play an important role in C. burnetii's pathogenicity. However, regarding the plasmid effectors, reports on their mutants are scarce. By using transposon mutagenesis, eight mutants of QpH1 genes and strong phenotypes were observed. Martinez, Cantet (13).
Detection of the C. burnetii using PCR amplification of chromosomal IS1111 repetitive elements has revealed the extent to which zoonotic reservoirs have dispersed C. burnetii into the USA, with 23.8% of over 1600 random environmental samples containing C. burnetii DNA [7]. Q fever outbreaks can have a substantial financial impact as illustrated by the 2007–2011 Netherlands outbreak (>4000 cases) where human disease burden and infection control measures were estimated to cost 307 million Euro (14). This study aimed to analyze the phylogeny of isolated C. burnetii isolates based on plasmid genes in milk samples (cow, sheep, goat, and buffalo) using the nested PCR method.
Sampling
Four hundred milk samples were collected randomly. The number of samples based on the type of livestock, geographic region, and seasons is given in Table 1. Also, the number of herds of cows, sheep, goats, and buffaloes was 10 each. The collected milk samples were placed on ice and immediately transferred to the microbiology laboratory at the Faculty of Veterinary Medicine.
DNA extraction
Ten ml of each milk sample was centrifuged at 2191g, and then the precipitate obtained from rinsing with DEPC water was used for DNA extraction with the Blood Genomic DNA Extraction Mini Kit (50 preps) (Favorgen, Taiwan). Furthermore, all extracted samples were examined with NanoDrop 2000c (Termo Scientific, USA) to investigate the quality and concentration of DNA.
Touchdown and Nested PCR
Used Primers
The primers used for amplifying the IS1111 gene were used according to a method by Khademi and Ownagh (18). Furthermore, Zhang and Hotta (19) utilized a method to amplify plasmid genes in this study. Table (1) presents the sequence of primers, temperature programs, and cycles.
Table 1. The amplification protocol names, thermal program for both touchdown and Trans PCR and primer names and sequences and the size of PCR products
| Reference | PCR condition (Cycle) | PCR product size (bp) | Sequence 5'----3' |
Primer Name | Protocol |
| (13, 15) |
95c for 3m, 94 c for 30s, 62-66 (5) for 30s, 72c for 1m, 72c for 10m. (35) | 687 | TATGTATCCACCGTAGCCAGTC | Trans 1 | Trans-PCR |
| CCCAACAACACCTCCTTATTC | Trans 2 | ||||
| 95c for 3m, 94 c for 30s, 54 for 20s, 72c for 1m, 72c for 10m. (35) | 203 | GAGCGAACCATTGGTATCG | 261F | nested-PCR | |
| CTTTAACAGCGCTTGAACGT | 463R | ||||
| (14) | 94 for 4m, 94 for2m, 53 for1m, 72 for2m, 72/5. (35) | 977 | ATAATGAGATTAGAACAACCAAGA | CB5 | PCR |
| TCTTTCTTGTTCATTTTCTGAGTC | CB6 | ||||
| This study | 94 for3m, 94 for45s, 50 for45s, 72 for45s, 72 for5m. (35) | 602 | CTCGCTGACGGAAGAGGATCTTTT | QpH1-F | nested-PCR |
| TAACACTGCCCGTCGCTTTACT | QpH1-R | ||||
| (14, 16) | 94 for4m, 94 for1m, 54 for1m, 72 for2m, 72 for7m. (36) | 693 | CTCGTACCCAAAGACTATGAATATATCC | QpRS1 | PCR |
| AACACCGATCAATGCGACTAGCCC | QpRS2 | ||||
| 94 for 3m, 94 for 30s, 51 for 20s, 72 for 90s, 72 for7m. (35) | 309 | ACTTTACGTCGTTTAATTCGC | QpRS3 | nested-PCR | |
| CACATTGGGTATCGTACTGTCCCT | QpRS4 | ||||
| (17) | 95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) | 513 | TGAAGCGGCGATTAAGCTAT | QpDG1 | PCR |
| GATGGCGGTGAGTACGGTTTT | QpDG2 | ||||
| 95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) | 265 | GGTTGCGCTATTTGAAGAGG | QpDG3 | Nested-PCR | |
| ATGTCCTTCTGCCACGACTT | QpDG4 | ||||
| (17) | 95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) | 548 | TTCCGCTACGTTTTTCAAGG | QpDV1 | PCR |
| CCAAGGTTTGGAAAAGCAAA | QpDV2 | ||||
| 95 for 3m, 95 for 30s, 55 for 20s, 72 for 60s, 72 for10m. (35) | 288 | ACTATCGTTCCCTGCCCTCT | QpDV3 | Nested-PCR | |
| AGCCACCGGTAAATACACGA | QpDV4 |
| Animal | Total | |||||
| Buffalo | Cattle | Sheep | Goat | |||
| Age group (Years old) | ||||||
| < 4 | 2/33 (6%) | 1/30 (3.3%) | 0/35 (0%) | 3/40 (7.5%) | 6/138 (4.3%) | |
| 5-10 | 5/32 (15.6%) | 6/30 (20%) | 2/30 (6.6%) | 4/31 (12.9%) | 17/123 (13.8%) | |
| >10 | 8/35 (22.9%) | 15/40 (37.5%) | 4/35 (11.4%) | 7/29 (24.1%) | 34/139 (24.5%) | |
| Season | ||||||
| Spring | 4/25 (16%) | 3/25 (12%) | 1/25 (4%) | 4/25 (16%) | 12/100 (12%) | |
| Summer | 8/25 (32%) | 11/25 (44%) | 3/25 (12%) | 6/25 (24%) | 28/100 (28%) | |
| Autumn | 3/25 (12%) | 6/25 (24%) | 1/25 (4%) | 3/25 (12%) | 13/100 (13%) | |
| Winter | 0/25 (0%) | 2/25 (8%) | 1/25 (4%) | 1/25 (4%) | 4/100 (4%) | |
| Region | ||||||
| North | 8/33 (24.2%) | 10/29 (34.5%) | 3/30 (10%) | 6/28 (21.4%) | 27/120 (22.5%) | |
| Center | 1/30 (3.3%) | 8/39 (20.5%) | 2/34 (5.9%) | 5/31 (16.1%) | 16/134 (11.9%) | |
| South | 6/37 (16.2%) | 4/32 (12.5%) | 1/36 (2.8% | 3/41 (7.3%) | 14/146 (9.6%) | |
| Plasmid | Animal | Total | |||
| Buffalo | Cattle | Sheep | Goat | ||
| QpH1 | 5 | 7 | 4 | - | 16 (25.8%) |
| QpRS | - | - | - | 5 | 5 (8%) |
| QpDV | 2 | 1 | 1 | 1 | 5 (8%) |
| QpDG | 2 | 2 | 2 | 1 | 7 (11.3%) |
![]() |
![]() |
| Figure 1. Agarose gel electrophoresis of amplified fragment of C. burnetii IS1111 gene (203 bp) using nested-PCR. ; Lane 1; 50-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 2, positive control; lanes 3, negative samples for C. burnetiidLane 4 and 7, Positive sample. | Figure 2. Agarose gel electrophoresis of amplified fragment of C. burnetii QpH1 gene (606 bp) by using nested-PCR. lanes 2, 3 and 5; positive samples for C. burnetii, Lane 6, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 7, Positive control; Lane 8, negative control |
![]() |
![]() |
| Figure 3. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpRS gene (309 bp) using nested-PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); Lane 2, Positive control (Nine Mile strain), lanes 3, 4, 5, and 6; positive samples for C. burnetii, Lane 7, negative control. | Figure 4. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpDV gene (288 bp) using nested PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lanes 2, 4, 5 positive samples for C. burnetii, Lane 6, negative control. |
Figure 5. Agarose gel electrophoresis of an amplified fragment of C. burnetii QpDG gene (265 bp) using nested PCR. Lane 1, 100-bp molecular ladder (Smobio Technology Inc., Taiwan); lanes 2, 3, 4 positive samples for C. burnetii, Lane 5, negative control.
Coxiella burnetii was detected in a proportion of available raw milk, confirming that individuals who purchase and drink raw milk in Iran may be exposed to this pathogen. Coxiella burnetii strains carry one of four large, conserved, autonomously replicating plasmids (QpH1, QpRS, QpDV, or QpDG) and a QpRS-like chromosomally integrated sequence of unknown function. All C. burnetii strains have one of the four different types of plasmids or one plasmid-like chromosomally integrated sequence. The plasmids’ role in C. burnetii biology has been implicated by identifying type IV secretion effectors among its genes (4, 20).
The QpH1 plasmid, first isolated from a tick, has been regularly found in isolates obtained from cattle, sheep, and goats (9). Several serological and Molecular studies have suggested that Q fever is distributed widely in Iran (15, 16, 18). In the present study, the QpH1, QpRS, QpDV, and QpDG specific sequences were detected in 16, 5, 5, and 7 samples with Q fever, respectively. This result indicates that different strains of C. burnetii have spread in cattle, goat, sheep, and buffalo milk in Iran. We also demonstrated that only 5 isolates originating from goats possessed the QpRS plasmid.
These data suggest that C. burnetii strains possessing the QpH1 plasmid are the most prevalent strain in Iran. Samuel et al. (6, 10) demonstrated that the isolates originating from patients with acute Q fever contained the QpH1 plasmid, while the isolates originating from patients with chronic Q fever possessed the QpRS plasmid or plasmid sequences integrated into the chromosome. However, because Q fever is still not diagnosed routinely in Iran, we have been unable to obtain detailed clinical data for these animals.
A study showed that fetal morbidity may be linked to the genotype of the infecting strain, as the plasmid QpDV was more common in isolates associated with abortions (21). As already reported in the literature (16), we found that the clinical manifestations of Q fever depended, at least in part, on the C. burnetii genotype, with strains carrying the QpDV plasmid being more frequently associated with acute Q fever (21). In addition, C. burnetii isolates associated with the QpH1 plasmid have been shown to have fewer deleted genes than the isolates harboring the QpRS and QpDV plasmids (21-27). Finally, the QpDV plasmid harbors sequence coding for four proteins not found in QpH1, which could explain the differences in clinical expression. However, as the plasmid type is associated with the genetic chromosome content (21), only the ongoing pangenome analysis of C. burnetii will determine the comprehensive genomic basis for the difference in virulence between strains.
The present findings were consistent with similar studies in Iran and other countries. Based on the findings of prevalence reported by many researchers, C. burnetii is more prevalent in cow's milk compared to the milk of other animals. The reason for the high prevalence of C. burnetii in cow's milk than in other animals, such as sheep is related to the fact that the vaginal discharge of C. burnetii is commonly very short in cows (less than 14 days), while it is discharged in milk. It persists for much longer periods, and the bacterium is mainly excreted via feces and vaginal mucosa in sheep (28, 29). Therefore, cow's milk can play an important role in the epidemiology of Q fever and greatly affects public health.
It was found that there was a significant relationship between age and discharge of C. burnetii in cow's milk. The finding was consistent with previous reports, indicating that age was a significant risk factor for the discharge of C. burnetii in cow's milk with a positive odds ratio of 1.67 times higher for each year of age (30). This study's results indicated that there was significant regional diversity in the discharge of Q fever agents in raw milk. C. burnetii was the highest milk contamination in the province's south. It was reported that the regional distribution of Q fever in human cases was similar to the distribution and population density of sheep and cows. Therefore, it can be assumed that the population of buffaloes, cows, and sheep, which discharged the bacterium, increased the positive samples (31).
Van der Hoek et al. and Khademi et al. reported a seasonal pattern of the onset of Q fever in humans in spring and early summer (18, 32). It was found that the increase in the incidence of Q fever in animals was related to the lambing season, in other words, the highest number of cases was reported during the summer in terms of spring lambing season in many European countries. The highest prevalence of C. burnetii discharge in milk was in summer, and the result was consistent with previous reports (5, 24).
If available, information on locally circulating strains may assist physicians in developing patient management strategies. The presented findings demonstrate QpDG and QpH1 to be closely related and likely identical. Consequently, there is no need to further sequence C. burnetii plasmids at this time. Experiments carried out to analyze the function, especially of the conserved and unique plasmid regions, seem to be more important for the understanding of C. burnetii biology. All C. burnetii isolates contained plasmids or plasmid-homologous sequences integrated into the chromosome, suggesting that these sequences harbor essential factors and/or perform essential functions for the organism. Mutagenesis and transformation experiments may uncover the underlying functions of the conserved and unique genes.
The obtained results showed that the raw milk of buffalo, cow, goat, and sheep could be important sources of Q fever. Age can be considered an important risk factor in the prevalence of C. burnetii in raw milk. C. burnetii discharge in milk follows a seasonal and regional pattern. The buffalo could play an important role in the epidemiology of Q fever in West Azerbaijan; hence, it should be considered in terms of public health. This study's results indicated that nested PCR assays were useful for directly typing C. burnetii plasmids in animal milk. Plasmid typing by PCR seems to be a more promising and useful method for applying as a golden standard method to detect the microorganism and so, rapid differentiation of C. burnetii in clinical samples owing to its sensitivity and specificity. Therefore, there is a need for more studies to validate nested PCR methods for early differentiation of acute Q fever from chronic Q fever.
This study has been carried out with the unhesitating support of the research assistant of the Faculty of Veterinary Medicine of Urmia University, supervisors, and respected officials of the Central Laboratory and Bacteriology Laboratory of the Veterinary Faculty. We hereby express our gratitude to all these dear ones.
Conflicts of Interest
This manuscript has not been published and is not under consideration for publication elsewhere. We have no conflicts of interest to disclose.
The authors would like to thank the dean of research and technology at Urmia University for funding the Ph.D. project.
| Rights and permissions | |
|
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License. |