, Yousef Amini1
, Morad Ali Ranayi1
, Zoleikha Avestan2
, Amir Hossein Mohagheghi-Fard1
, Mehdi Zandhaghighi1
, Zakaria Bameri1
, Ebrahim Kord1
, Shahram Shahraki-Zahedani3
, Aslam Dehvari1
Acinetobacter spp. complex includes species with varying levels of clinical importance, of which Acinetobacter baumannii and A. nosocomialis are of particular significance (1). However, they have different associations with human health (2). A. baumannii is one of the most important nosocomial pathogens due to its longevity in the hospital environment and resistance to various antimicrobial agents, giving it the ability to colonize susceptible patients treated with broad-spectrum antibiotics (3, 4). Acinetobacter baumannii is involved in different infections such as bacteremia, urinary tract infection, endocarditis, pneumonia, secondary meningitis, surgical wound infection, skin and soft tissue infection, and septicemia (5-7). As of today, A. baumannii has developed the ability to withstand different classes of antibiotic components such as beta-lactam, carbapenem, and aminoglycosides (8-10). Different types of beta-lactamases have been identified based on their characteristics and activities (11). Extended-spectrum beta-lactamases (ESBLs) are a group of enzymes that can hydrolyze beta-lactam antibiotics, including penicillin, expanded-spectrum cephal-osporins, fourth generation cephalosporins (cefepime), and aztreonam (12). The most important enzymes initially identified in 1980 were shv and tem (beta-lactamase genes). In addition to the main families, new families of ESBLs, including per, veb, bel, tla, ges, and bes have emerged globally. In fact, the rapid transmission and dissemination of these genes has increased the prevalence of nosocomial infections (13, 14). The present study aimed to investigate the prevalence of per, veb, tem, and shv genes and their relationship with antimicrobial resistance among A. baumannii strains isolated from patients referred to educational hospitals in Zahedan, Iran.
2.1 Bacterial Isolation and Identification:
A total of 150 non-duplicate isolates of A. baumannii were collected from two hospitals (Ali-ibn-Abi-Talib and Khatam) in Zahedan, southeast of Iran, from January to September 2018. The sources of the bacterial isolates were human urine, blood, wound, and bronchoalveolar lavage fluid. Medical microbiological tests including Gram staining, growth at 44°C, oxidase test, O/F test and conventional biochemical methods were used to identify A. baumannii isolates (15). Moreover, Molecular differentiation of ABC complex was investigated by presence of blaoxa-51-like family and gyrB multiplex PCR.
2.2 Antimicrobial Susceptibility
Kirby Bauer disk diffusion method was used to find susceptibility for Amikacin (30μg), Gentamycin (10μg), Minocycline (30μg), Doxycycline (30μg), Tetracycline (25μg), Ampicillin-sulbactam (20μg), Piperacillin (100μg), Piperacillin beta-lactamase (100/10μg), Cefepime (30μg), Levofloxacin (5μg), Cotrimoxazole (25μg), Imipenem (10μg), Meropenem (10μg), Tobramycin (10μg), Cefotaxime (30μg), Cefazolin (30μg), and Ciprofloxacin (5μg). According to the guidelines (CLSI, 2018), the diameter of inhibition zones was determined to show resistance, intermediate, and sensitivity of each isolate against antibiotics. Escherichia coli ATCC25922 and Pseudomonas aeruginosa ATCC27853 were used as the control strains.
2.3 Determination of the Minimum Inhibitory Concentration (MIC)
The MIC of Colistin was determined for all A. baumannii species isolates using the disk diffusion test and broth microdilution method according to the guidelines of the CLSI (16). Escherichia coli ATCC 25922 was used as the reference strain.
2.4 DNA Extraction and PCR Amplification:
As previously described, the boiling method was used to extract genomic DNA (17). DNA extraction concentration and quality were checked with 1.5% agarose gel and Nanodrop. The presence of oxa-51, spf-2, spf-4, per, veb, tem, and shv genes in A. baumannii strains were detected by PCR. The PCR was performed in a final volume of 20 µL containing 1 µL of isolate genomic DNA (~70 ng/mL), 10 µL of master mix (Ampliqon Taq 2x Master Mix, Denmark), 1.0 µL of each primer 10 ng/mL (Table 1), and 6 µL of distilled water (SinaClon Bio-Science Co., Tehran, Iran), The PCR products were analyzed by electrophoresed on agarose gel and then observed with a transilluminator under UV light.
2.5 statistical Analyses
Statistical analyses were performed using SPSS software version 22.0 (SPSS, Chicago, IL, USA).
| Genes | Primers | Sequence (5′ to 3′) | fragments | Annealing Temp | Reference |
| oxa-51 | F | TAATGCTTTGATCGGCCTTG | 352bp | 52 | (17) |
| R | TGGATTGCACTTCATCTTGG | ||||
| spf-2 | F | GTTCCTGATCCGAAATTCTCG | 294bp | 60 | (18) |
| R | AACGGAGCTTGTCAGGGTTA | ||||
| spf-4 | F | CACGCCGTAAGAGTGCATTA | 490bp | 60 | (18) |
| R | AACGGAGCTTGTCAGGGTTA | ||||
| veb | F | CGACTTCCATTTCCCGATGC | 643bp | 58 | (19) |
| R | GGACTCTGCAACAAATACGC | ||||
| per | F | GCAACTGCTGCAATACTCGG | 340bp | 56 | (19) |
| R | ATGTGCGACCACAGTACCAG | ||||
| tem | F | TTTCGTGTCGCCCTTATTCC | 404bp | 57 | (20) |
| R | ATCGTTGTCAGAAGTAAGTTGG | ||||
| shv | F | CGCCTGTGTATTATCTCCCT | 290bp | 57 | (20) |
| R | CGAGTAGTCCACCAGATCCT |
3.1 Patients and Bacterial Isolation
The isolates were used in the previous study (15). As reported previously, 141 A. baumannii strains were isolated from bronchoalveolar lavage fluid (50.4%), blood (39.7%), urine (2.1%), and wound (7.8%) samples. The samples were obtained from patients with a mean age of 40.77±23.49 years, of whom 86 (61%) were male and 55 (39%) female.
3.2 Molecular Identification of Acinetobacter species
Biochemical tests showed that all isolates belonged to A. baumannii species. As reported previously, A. baumannii species was confirmed by positive for oxa-51 gene PCR. Moreover, A. baumannii and A. nosocomial were differentiated by spf-2 and spf-4 amplifications. Among all positive isolates, 100% of isolates were positive for spf-2, whereas 141 out of 150 isolates were positive for another spf (spf-4) showing there are 141 A. baumannii and only nine A. nosocomial (15).
3.3 Antibiotic susceptibility testing
As reported previously, the highest levels of resistance were observed against cefazolin (100%), aztreonam and ceftazidime (98.6%), piperacillin, and cefotaxime (97.9%). Moreover, the frequency of MDR and extensively drug-resistant (XDR) isolates was 97.2 and 41.1%), respectively. Since all isolates were susceptible to colistin (MIC ≤ 2 μg/mL), we did not have pan-drug-resistant (PDR) isolates (15).
3.4 ESBLs Genotypes
Molecular analysis showed that 15.4% and 7.3% of isolates harbored tem and shv, and 13.3% and 10% of them carried veb and per genes, respectively (Figure.1). Combination (Com) analyses between veb and per genes showed that three isolates were positive for both genes (Com-1, veb+, per+) and 118 isolates lacked them (Com-4, veb-, per-). The current study results showed that 17 and 12 samples were only positive for veb (Com-2, veb+, per-) and per (Com-3, veb-, per+), respectively. Analyses between tem and shv genes showed that four isolates were positive for both genes (Com-5, shv+, tem+) and 120 isolates lacked them (Com-4, shv-, tem-). Molecular analysis showed that 7 and 19 samples were positive only for shv (Com-6, shv+, tem) and tem (Com-7, shv-, tem+), respectively. Moreover, the relation between gene frequency and antimicrobial agents was investigated. There was no significant correlation between resistance genes and Antibiotic agents (p > 0.05; Table.2).
Table 2. Relation between gene frequency and antimicrobial agents in A. baumannii species isolates (R= Resistance, I= Intermediate, S= Sensitive, P= Positive, N= Negative
| Antimicrobial agents | Mn(30μg) | DXT(30μg) | T(25μg) | SAM(20 μg | PRL(100μg) | PTZ(100 μg) | CPM(30 μg) | ||||||||||||||||
| R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | |||
| veb |
P | 5 | 3 | 12 | 10 | 0 | 10 | 15 | 0 | 5 | 13 | 3 | 4 | 19 | 1 | 0 | 19 | 0 | 1 | 18 | 1 | 1 | |
| N | 19 | 12 | 99 | 53 | 12 | 65 | 90 | 22 | 18 | 74 | 34 | 22 | 125 | 3 | 2 | 126 | 1 | 3 | 117 | 4 | 9 | ||
| per |
P | 3 | 2 | 10 | 8 | 1 | 6 | 12 | 1 | 2 | 10 | 3 | 2 | 14 | 1 | 0 | 15 | 0 | 0 | 14 | 0 | 1 | |
| N | 21 | 13 | 101 | 55 | 11 | 69 | 93 | 21 | 12 | 77 | 34 | 24 | 130 | 3 | 2 | 130 | 1 | 4 | 121 | 5 | 9 | ||
| shv |
P | 3 | 1 | 7 | 6 | 1 | 4 | 8 | 1 | 2 | 7 | 3 | 1 | 10 | 1 | 0 | 11 | 0 | 0 | 10 | 0 | 1 | |
| N | 15 | 6 | 118 | 62 | 9 | 68 | 98 | 18 | 23 | 81 | 32 | 26 | 132 | 4 | 1 | 133 | 1 | 5 | 125 | 5 | 9 | ||
| tem | P | 5 | 4 | 14 | 13 | 2 | 8 | 12 | 4 | 7 | 12 | 5 | 6 | 16 | 7 | 0 | 21 | 0 | 2 | 20 | 0 | 3 | |
| N | 18 | 11 | 98 | 53 | 9 | 66 | 82 | 20 | 25 | 72 | 32 | 23 | 121 | 4 | 2 | 118 | 2 | 7 | 117 | 3 | 7 | ||
| Antimicrobial agents | Lev(5 μg) | SXT(25 μg) | IMI(10 μg) | MEM(10 μg) | TN(10 μg) | CTX(30 μg) | CAZ(30 μg) | CP(5 μg) | ||||||||||||||||||||
| R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | R | I | S | |||||
| veb |
P | 19 | 0 | 1 | 20 | 0 | 0 | 19 | 0 | 1 | 20 | 0 | 0 | 17 | 1 | 2 | 20 | 0 | 0 | 20 | 0 | 0 | 19 | 0 | 1 | |||
| N | 124 | 3 | 3 | 123 | 2 | 5 | 117 | 0 | 13 | 115 | 2 | 13 | 101 | 6 | 23 | 130 | 0 | 0 | 128 | 2 | 0 | 118 | 0 | 12 | ||||
| per |
P | 15 | 0 | 0 | 15 | 0 | 0 | 13 | 0 | 2 | 14 | 1 | 0 | 11 | 2 | 2 | 15 | 0 | 0 | 15 | 0 | 0 | 14 | 0 | 1 | |||
| N | 128 | 3 | 4 | 128 | 2 | 5 | 123 | 0 | 12 | 121 | 1 | 13 | 107 | 5 | 23 | 135 | 0 | 0 | 133 | 0 | 2 | 113 | 0 | 10 | ||||
| shv |
P | 11 | 0 | 0 | 11 | 0 | 0 | 10 | 0 | 1 | 9 | 2 | 0 | 8 | 2 | 1 | 10 | 1 | 0 | 11 | 0 | 0 | 8 | 0 | 3 | |||
| N | 133 | 8 | 9 | 134 | 7 | 9 | 135 | 0 | 15 | 132 | 5 | 13 | 118 | 5 | 27 | 136 | 2 | 12 | 139 | 7 | 4 | 128 | 5 | 17 | ||||
| tem |
P | 23 | 0 | 0 | 21 | 0 | 2 | 21 | 0 | 2 | 17 | 1 | 5 | 16 | 3 | 4 | 22 | 1 | 0 | 23 | 0 | 0 | 17 | 3 | 3 | |||
| N | 131 | 8 | 11 | 135 | 9 | 6 | 138 | 0 | 12 | 133 | 3 | 14 | 117 | 8 | 25 | 141 | 5 | 4 | 144 | 0 | 6 | 135 | 2 | 13 | ||||
Acinetobacter baumannii is considered one of the seriously health-threatening pathogens, which causes many infections such as pneumonia, urinary tract infections, wound infections, bacteremia, and meningitis (6, 21, 22). One of the main concerns in treating A. baumannii is its resistance to a wide range of antibiotics, including the latest treatment options Beta-lactamase and carbapenems, caused by the overuse of these drugs. Detection of ESBL genes involved in resistance is important for treatment and epidemiology studies (22). Molecular methods such as PCR determine which ESBL gene exists in the isolate (12). In this study, the highest number of isolates was obtained from ICU. Moreover, A. baumannii was mostly found in trachea samples. Almost similar results were observed in a study by Sana Islahi et al. in India (23). In the current study, almost 93.6% of the Acinetobacter strains isolated were shown to be A. baumannii, whereas A. nosocomialis only constituted 6.3% (nine out of 150 samples). A. baumannii appears to be an important cause of infections (24). According to the study results by Ardebili et al. 81.3% and 18.7% of the collected isolates were A. baumannii and A. nosocomial, respectively (25). In this study, all 141 A. baumannii isolates were susceptible to colistin (MIC ≤2 μg/ml), and only 20 isolates (14.2%) were resistant to Minocycline. Our results also suggest that colistin can be a proper choice against A. baumannii isolates in vitro, which is in line with the findings of other studies (21, 26, 27), which report colistin and tigecycline as the most effective antibiotics against A. baumannii isolates (4). In another study in Iran, Sharif et al. concluded that more than 90% of A. baumannii isolates were resistant to Ceftadizim, Ceftriaxone, and Cefepime. Similar to our study, the resistance to imipenem was determined to be 95%, with no reported colistin resistance (28). In the present study, the resistance rate against imipenem is in line with the findings presented by Farajnia et al. in 2013 (˃80%) (26) and is in contrast with Hujer et al. in 2006 (20%)- (29). The determined resistance rate of meropenem (92%) is in contrast with the findings (25%) of Hujer et al. (29). The congruent findings noted above may be due to similar research processes, while the conflicting results can be due to using different types of samples, the type of antibiotic disks used and variation in performing the antibiotic susceptibility test. Molecular analysis showed that 15.4 %, 7.3 %, 13.3%, and 10% of the isolates harbored tem, shv, veb, and per genes, respectively (Figure.1). In our study, the highest frequency of ESBLs gene isolates belonged to the ICU and internal ward, respectively. Interestingly, the samples isolated from ETT (Endotracheal) showed the highest rate of the studied gene, followed by and blood culture. One of the reasons for this observation could be the higher use of β-lactam antibiotics to treat infections and the consequent increased expression of β-lactam resistant genes in the strains isolated from these samples. In a study in Iran Fallah et al. showed that out of 91 A. baumannii isolates, 78.03% and 39.5% were positive for per and veb genes, respectively. Their results showed remarkable differences from those of the current study, which may be due to different regions of studies (20). In another study performed in the Northwest of Iran, Farajnia et al. (26) found that only 10% of the 100 isolates of A. baumannii were positive for veb, while 51% were positive for per. Furthermore, the antimicrobial resistance pattern showed that A. baumannii strains were highly resistant to cefepime (88%), gentamicin (78%), ciprofloxacin (78%), levofloxacin (76%), meropenem (63%), imipenem (62%), and ampicillin-sulbactam (55%) (30). In a study in Korea, Yang et al. detected 53 per+ A. baumannii strains out of 97 isolates examined (27). Dai et al., reported that among 39 A. baumannii isolates, two carried shv gene, while 15 strains harbored tem (30). Interestingly, the frequency of shv in the current study was significantly different from that reported by Taherikalani et al., which did not detect shv in any of the studied isolates (31).
The present study showed high antimicrobial resistance among isolated A. baumannii in Zahedan, Southeast Iran. Although the prevalence of per, veb, tem, and shv genes were less than those reported from other regions, it is necessary to review the prescription pattern of antibiotic agents.
These results indicate that ESBL genes play a special role in creating antimicrobial resistance among the studied strains of A. baumannii. These findings underscore the need for antimicrobial monitoring to control the spread of resistance.
The authors would like to thank the University of Medical Sciences, Zahedan, Iran, for supporting this project.
This study was supported by the Research Deputy of Zahedan University of Medical Sciences (Grant No. 1397.276 IR.ZAUMS.REC).
Conflicts of Interest
| Rights and permissions | |
|
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License. |