, Hamidreza Jamaati2
, Naghmeh Bahrami3
, Behrooz Farzanegan4
, Mahsa Rekabi5
, Mogtaba Mokhber Dezfuli6
, Jalal Heshmat Nia2
, Mohammadreza Madani2
, Mahya Daustani7
, Sadegh Shirian8
, Ladan Masoumi9
, Amir Ghaemi10
, Armita Narimani11
, Mehran Khakbaz11
, Abdolreza Mohamadnia12
, Mohammad Varahram13
, Ali Akbar Velayati13
The current outbreak of coronavirus infectious disease 2019 (COVID-19) has recently spread to many countries throughout the world, which has caused a great deal of concern. Despite many efforts, currently, there is no vaccine or targeted treatment for COVID-19 (1).
Most coronaviruses cause disease in certain species of hosts. Some cases can lead to a significant infectious threat to humans and cause severe respiratory disease (2-4). Of course, Covid-19 is not the first respiratory disease caused by a coronavirus. However, in the last decade, there have been other epidemic diseases, such as Severe Acute Respiratory Syndrome (SARS) and the Middle East Respiratory Syndrome (MERS)(5).
According to performed studies, the disease in people with Covid-19 may be severe or mild.
People with serious infections often have other underlying diseases, such as Diabetes, Immuno-deficiency, or cardiovascular diseases, which in turn accelerates the progression of the infection in them and sometimes leads to death (6-9).
Patients with Covid-19 show clinical manifestations such as fever, cough, dyspnea, fatigue, and decreased Leukocyte count, and pneumonia radiography, which is actually similar to the symptoms of SARS-COV and MERS-COV (6, 10).
According to a report in Lancet, ARDS is the main cause of mortality in patients with Covid-19. ARDS is a common immunological event for SARS-COV, 2-SARS-COV, and MERS-COV infections (6).
One of the main mechanisms for ARDS is the Cytokine storm, which is, in fact, an uncontrolled systemic inflammatory response that causes death, which is due to release large amounts of pre-inflammatory cytokines such as IL-6, IL-12, IL -18, IFN-g, TNF-α and TGF-β (11).
Accordingly, and considering clinical findings and manifestations, the number of inflammatory cytokines in people with severe Covid-19 infection will be different from the amount of these cytokines in patients with mild-moderate infection (12).
Clinical diagnoses in infections such as Covid-19 can be done using biological samples such as blood and sputum through the Real-time PCR method, which also has good sensitivity and uniqueness (13).
In this study, the expression evaluation of IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α cytokines in patients with severe Covid-19 and its comparison with mild type has been performed by Real-time PCR method.
Sample Collection
A total of 30 blood samples were taken from patients with severe COVID-19 who admitted to the ICU due to severe symptoms. Moreover, 30 people who the result of their CORONA test was positive, and had mild-moderate symptoms, and was hospitalized in the infectious-internal medicine wards participated in the study voluntarily. In both groups, patients were randomly selected, and patients who had similar symptoms but tested negative for Covid-19 were excluded from the study. The study was conducted as a case-control study in the period of 1400 in Masih Daneshvari Hospital, Iran.
Blood Preparation and RNA Extraction
After selecting subjects, 2 mL of peripheral blood was taken through a bleeding syringe in a tube containing the EDTA, and immediately the RNA extraction stage started.
RNA extraction was performed using the RNA Blood Mini Kit (Qiagen Cat no.52304) and according to Kit's protocol. RNA concentrations were determined using a spectrophotometer (NanoDrop, 2000, Thermo).
cDNA synthesis and Real-Time RT-PCR
RNAs were reverse-transcribed to cDNA using Viva 2-steps RT-PCR Kit cDNA Synthesis Kit (Vivantis, Malaysia). The expression levels of cytokines were determined using Cinna GreenqPCR Mix, 2X (Cina Colon, Iran) by real-time PCR (Applied Biosystems, USA). The reference gene 18srRNA was used as the normaliser in RT-qPCR. The sequences of the primer sets used are presented in the Table 1.
Real-time RT-PCR Reaction Components
The relative real-time PCR cycle consisted of initial denaturation at 95 for 5 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, primers connection at 56°C for 1 minute, amplification at 72 for 25 seconds and the final amplification at 72 For 5 min. After completing each reaction, the interpretation of the results has been carried out based on the Amplification and Melting peak curves. To determine the gene expression amplification of patients with severe symptoms in patients with severe symptoms compared to patients with mild symptoms the 2-ΔΔCt formula was used (14-19). Three cDNA vials made from patients were tested to express the reference and the studied genes.
Table 1. Sequence and specifications of primers used
| IL-6 | IFN-α | IL-12 | TGF-β | IL-8 | TNF-α | 18srRNA | |
| Forward primer | GGTACATCCTCGACGGCATCT | GACTCCATCTTGGCTGTGA | TCAAACCAGACCCACCGAA | CCCAGCATCTGCAAAGCTC | GAGAGTGATTGAGAGTGGACCAC | CCGAGGCAGTCAGATCATCTT | GTAACCCGTTGAACCCCATT |
| Length | 21 | 19 | 19 | 19 | 23 | 21 | 20 |
| Reverse primer | GTGCCTCTTTGCTGCTTTCAC | TGATTTCTGCTCTGACAACCT | GCTGACCTCCACCTGCTGA | GTCAATGTACAGCTGCCGCA | CACAACCCTCTGCACCCAGTTT | AGCTGCCCCTCAGCTTGA | CCATCCAATCGGTAGTAGCG |
| Length | 21 | 21 | 19 | 20 | 22 | 18 | 20 |
| product length | 81 | 103 | 68 | 101 | 112 | 85 | 152 |
| Annealing temperature | 59 | 56 | 58 | 59 | 59 | 58 | 56 |
Statistical Analysis
The sample size was calculated according to the ratio of positive markers in both groups, and taking into account 5% and 20% of the first and second types of errors respectively.
The results were analyzed using SPSS Version 20, and the mean and standard deviations were also calculated. The paired t-test was used to analyze the difference or correlation between gene expression levels and Clinicopathologic Features. The difference was considered significant at P≤0.05.
This study included 30 patients with COVID-19, who were admitted to the ICU due to severe symptoms, as well as 30 people who the result of their CORONA test was positive, and had mild-moderate symptoms, and were hospitalized in the infectious-internal medicine wards.
The group of patients with severe symptoms consisted of 21 males and 9 females, and the group of patients with mild symptoms consisted of 20 males and 10 females. There was no significant difference between two groups in terms of average age (Table. 2). Patients with severe and mild symptoms were tested for LDH and showed a significant increase in the mean serum levels of LDH in the ICU patients compared to the ward group (P= 0.003). The serum levels of CRP, vitamin D3, and hemoglobin showed no significant difference between two groups (Fig. 1 and Table 2). In the ICU patients the mean number of WBCs (P<0.001) and neutrophils (P= 0.004) were significantly increased compared to the ward group. However, the mean numbers of lymphocytes were significantly decreased in the ICU patients compared to the ward group (P= 0.001).
Table 2. Laboratory data diagrams information of patients with COVID-19 stratified by two clinical types
| group | N | Mean | Std. Deviation | P -value | |
| Age | Ward | 30 | 53.4667 | 16.48141 | 0.875 |
| ICU | 30 | 54.2333 | 16.26225 | ||
| LDH | Ward | 30 | 443.2593 | 201.78465 | 0.003 |
| ICU | 30 | 969.3077 | 866.75716 | ||
| WBC | Ward | 30 | 6.8817 | 2.42745 | 0.000 |
| ICU | 30 | 11.3523 | 5.97583 | ||
| Hg | Ward | 30 | 13.8833 | 1.69443 | 0.161 |
| ICU | 30 | 13.1333 | 2.34864 | ||
| Neutrophil | Ward | 30 | 64.8333 | 12.85753 | 0.004 |
| ICU | 30 | 75.2667 | 14.36455 | ||
| Lymphocyte | Ward | 30 | 25.4000 | 10.09814 | 0.001 |
| ICU | 30 | 16.3000 | 10.43915 | ||
| CRP | Ward | 30 | 0.3571 | 0.49725 | 0.120 |
| ICU | 30 | 0.1176 | 0.33211 | ||
| VitD3 | Ward | 30 | 26.8333 | 15.05213 | 0.450 |
| ICU | 30 | 41.8000 | 43.78584 |
Figure 1. Laboratory data diagrams in severe and mild COVID-19 cases.
The Analysis of the Cytokines Expression
The relative expression of each gene varies in different patients. Evaluating the specific peak of the studied product can ensure that Real-time PCR is unique.
IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α markers in the peripheral blood of patients with severe symptoms, were positive on 28/30 (93.33%), 27/30 (90%), 24/30 (80%), 25/30 (83.33%), 26/30 (86.66%), and 27/30 (90%) respectively. The positive rate of these markers in the group of patients with mild symptoms was 20/30 (66.67%), 21/30 (70%), 18/30 (60%), 17/30 (56.67%), 19/30 (63.33%), 18/30 (60%), respectively. The statistical comparison of the positivity of these markers in both groups was performed using the two-sample binomial test, which showed that there was a statistically significant difference between these two groups (P< 0.001) (Fig. 2). The obtained data from gene expression levels showed that the relative expression level of IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α cytokines in the group of patients with severe symptoms versus the ward group were 1.08, 1.14, 1.09, 1.10, 1.22, and 1.12, respectively (Fig. 3).
Cytokines are low molecular weight proteins or glycoproteins. These compounds can be considered as immune system hormones and inflammatory responses (20, 21). Cytokines, in general, affect the activity, differentiation, amplification, and survival of immune cells, as well as regulate the production and activity of other cytokines, which can increase (pre-inflammatory cytokines) or decrease (anti-inflammatory cytokines) the inflammatory response (21).
In the event of injury or infection in an organ or limb, an immune response is formed to suppress the infection, in which the release of pre-inflammatory cytokines during inflammation indicates the body's attempt to respond to the infection (22). There is a dynamic and changeable balance in two directions, between pre-inflammatory cytokines and anti-inflammatory compounds of the immune system. Any change in this balance will lead to dangerous effects on the individual (21, 23-25).
A number of cytokines play an important role in causing acute inflammation (26). The development of the disease is strongly related to the expression level of inflammatory cytokines and chemokines (27-30). Various cytokines and innate immune cells have been associated with immunopathology in coronavirus (31-33).
This study examined the expression of several cytokine genes in patients with COVID-19 in a group with severe clinical symptoms and admitted to ICU, compared with the group with mild clinical symptoms hospitalized in the infectious-internal medicine wards and Real-time PCR technique is used in it. The technique has good sensitivity to molecular evaluations.
Several studies have shown that unregulated and excessive immune responses may lead to immunopathology and fatal disease in the patient (34, 35). It is believed that host immune responses play a major role in the complications of diseases caused by SARS-CoV and MERS-CoV infections (36).
In our study, using Ct values obtained from real-time PCR reactions and performed calculations, the increase of cytokine genes expression in patients admitted to the ICU with severe symptoms were shown compared with patients with mild symptoms admitted to infectious wards.
According to a report in Lancet, ARDS is the main cause of mortality in patients with Covid-19 (37). Several pre-inflammatory cytokines such as IL-8 and IL-1β, are involved in the pathogenesis of ARDS (38). ARDS is considered the main cause of mortality in patients with SARS-CoV or MERS-CoV (38).
One of the main mechanisms for ARDS is the Cytokine storm, which is, in fact, an uncontrolled systemic inflammatory response that causes death, which is due to release large amounts of pre-inflammatory cytokines such as IFN-a, IFN-g, IL-1b, IL-6, IL- 12, IL-18, IL-33, TNF-a, TGFb, etc (11, 39).
The study of C.K. Min et al. demonstrated that people with severe MERS-CoV infections, as those with SARS-CoV, reveal higher serum levels of IL-6, IFN-a, CCL5, CXCL8, and CXCL-10 compared to those with the mild disease (12). In our study, an increase in the cytokines expression of IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α was observed in the peripheral blood of patients with severe symptoms compared with patients with mild symptoms.
In the study of Bandar Alosaimi et al. (2019), an increased inflammatory response was reported in patients with severe MERS-CoV infection that sometimes progressed to cause ARDS, which is in line with the present study, in which increased expression of inflammatory cytokines in patients with Severe COVID-19 was shown (40).
The evidence of performed studies on SARS and respiratory syncytial virus (HRSV) has shown that there has been an increase in IL-8 with acute SARS infection, bronchiolitis, immunopathology, and disease enhancement during infection HRSV (41). In a recent study, IL-8 also has shown an increase in severe cases.
In general, coronavirus infection, which affects human lungs, lead to inflammatory reactions in the human body, and the immune cells release a large amount of pre-inflammatory, inflammatory and anti-inflammatory cytokines that are called cytokine storms and these reactions cause serious complications and injuries in patients. It seems that in patients with more severe complications, who are admitted to the ICU, release of inflammatory cytokines, is more than patients with milder symptoms. The present study also showed an increase of IL-6, IFN-α, IL-12, TLF-β, IG-8 and TNF-α cytokine gene expression in the peripheral blood of patients with severe symptoms compared to patients with mild symptoms, which as a result of increasing the expression of these genes, the cytokines are produced and enter the bloodstream, causing inflammatory and even destructive reactions at their target sites.
It should be noted that the disease caused by the coronavirus (COVID-19), is a new disease, and in order to achieve more complete and comprehensive results, more research is needed for better diagnoses and treatments.
This study was approved by University ethical Committee (Ethical Code: IR.SBMU.NRITLD.REC. 1399.042) and all patients filled out an informed consent form.
This research is a part of the efforts of the professors and colleagues of Masih Daneshvari Hospital of Shahid Beheshti University of Medical Sciences. All involved are sincerely thanked.
None.
Conflicts of Interest
There is no conflict of interest between the authors.
| Rights and permissions | |
|
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License. |