year 16, Issue 5 (September - October 2022)                   Iran J Med Microbiol 2022, 16(5): 412-419 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kazempour Dizaji M, Jamaati H, Bahrami N, Farzanegan B, Rekabi M, Mokhber Dezfuli M, et al et al . Effect of Cytokines Gene Expression and Serum Level of Vitamin D on the Severity of COVID-19. Iran J Med Microbiol 2022; 16 (5) :412-419
URL: http://ijmm.ir/article-1-1812-en.html
1- Biostatistics Department, Mycobacteriology Research Center, National Research Institute of Tuberculosis and lung Diseases, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
2- Chronic Respiratory Diseases Research Center, National Research Institute of Tuberculosis and Lung Diseases (NRITLD), Shahid Beheshti University of Medical Sciences, Tehran, Iran
3- Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, Iran
4- Critical Care Quality Improvement Research Center at Shahid Modarres Hospital, Department of Anesthesiology, Shahid Beheshti University of Medical Sciences, Tehran, Iran
5- Pediatric Respiratory Diseases Research Center, National Research Institute of Tuberculosis & Lung Diseases (NRITLD), Masih Daneshvari Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
6- Lung transplantation Research Center, National Research Institute of Tuberculosis, and lung Diseases, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
7- Department of Biotechnology, Faculty of Sciences, Islamic Azad University, Tehran, Iran
8- Department of Pathology, School of Veterinary Medicine, Shahrekord University, Shahrekord, Iran
9- Shefa Khatam Neuroscience Research Center, Tehran, Iran
10- Department of Virology, Pasture Institute, Tehran, Iran
11- Department of Cell and Molecular Biology, School of Biological Sciences, North Tehran Branch, Islamic Azad University, Tehran, Iran
12- Department of Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran , mohamadnia.ar@gmail.com
13- Mycobacteriology Research Center, National Research Institute of Tuberculosis and Lung Diseases (NRITLD), Shahid Beheshti University of Medical Sciences, Tehran, Iran
Full-Text [PDF 584 kb]   (1060 Downloads)     |   Abstract (HTML)  (3700 Views)
Full-Text:   (1051 Views)
Introduction


The current outbreak of coronavirus infectious disease 2019 (COVID-19) has recently spread to many countries throughout the world, which has caused a great deal of concern. Despite many efforts, currently, there is no vaccine or targeted treatment for COVID-19 (1).
Most coronaviruses cause disease in certain species of hosts. Some cases can lead to a significant infectious threat to humans and cause severe respiratory disease (2-4). Of course, Covid-19 is not the first respiratory disease caused by a coronavirus. However, in the last decade, there have been other epidemic diseases, such as Severe Acute Respiratory Syndrome (SARS) and the Middle East Respiratory Syndrome (MERS)(5).
According to performed studies, the disease in people with Covid-19 may be severe or mild.
People with serious infections often have other underlying diseases, such as Diabetes, Immuno-deficiency, or cardiovascular diseases, which in turn accelerates the progression of the infection in them and sometimes leads to death (6-9).
Patients with Covid-19 show clinical manifestations such as fever, cough, dyspnea, fatigue, and decreased Leukocyte count, and pneumonia radiography, which is actually similar to the symptoms of SARS-COV and MERS-COV (6, 10).
According to a report in Lancet, ARDS is the main cause of mortality in patients with Covid-19. ARDS is a common immunological event for SARS-COV, 2-SARS-COV, and MERS-COV infections (6).
One of the main mechanisms for ARDS is the Cytokine storm, which is, in fact, an uncontrolled systemic inflammatory response that causes death, which is due to release large amounts of pre-inflammatory cytokines such as IL-6, IL-12, IL -18, IFN-g, TNF-α and TGF-β (11).
Accordingly, and considering clinical findings and manifestations, the number of inflammatory cytokines in people with severe Covid-19 infection will be different from the amount of these cytokines in patients with mild-moderate infection (12).
Clinical diagnoses in infections such as Covid-19 can be done using biological samples such as blood and sputum through the Real-time PCR method, which also has good sensitivity and uniqueness (13).
In this study, the expression evaluation of IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α cytokines in patients with severe Covid-19 and its comparison with mild type has been performed by Real-time PCR method.


 

Materials and Methods

Sample Collection

A total of 30 blood samples were taken from patients with severe COVID-19 who admitted to the ICU due to severe symptoms. Moreover, 30 people who the result of their CORONA test was positive, and had mild-moderate symptoms, and was hospitalized in the infectious-internal medicine wards participated in the study voluntarily. In both groups, patients were randomly selected, and patients who had similar symptoms but tested negative for Covid-19 were excluded from the study. The study was conducted as a case-control study in the period of 1400 in Masih Daneshvari Hospital, Iran.

Blood Preparation and RNA Extraction

After selecting subjects, 2 mL of peripheral blood was taken through a bleeding syringe in a tube containing the EDTA, and immediately the RNA extraction stage started.
RNA extraction was performed using the RNA Blood Mini Kit (Qiagen Cat no.52304) and according to Kit's protocol. RNA concentrations were determined using a spectrophotometer (NanoDrop, 2000, Thermo).

cDNA synthesis and Real-Time RT-PCR

RNAs were reverse-transcribed to cDNA using Viva 2-steps RT-PCR Kit cDNA Synthesis Kit (Vivantis, Malaysia). The expression levels of cytokines were determined using Cinna GreenqPCR Mix, 2X (Cina Colon, Iran) by real-time PCR (Applied Biosystems, USA). The reference gene 18srRNA was used as the normaliser in RT-qPCR. The sequences of the primer sets used are presented in the Table 1.

Real-time RT-PCR Reaction Components

The relative real-time PCR cycle consisted of initial denaturation at 95  for 5 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, primers connection at 56°C for 1 minute, amplification at 72  for 25 seconds and the final amplification at 72  For 5 min. After completing each reaction, the interpretation of the results has been carried out based on the Amplification and Melting peak curves. To determine the gene expression amplification of patients with severe symptoms in patients with severe symptoms compared to patients with mild symptoms the 2-ΔΔCt formula was used (14-19). Three cDNA vials made from patients were tested to express the reference and the studied genes.
 

Table 1. Sequence and specifications of primers used

IL-6 IFN-α IL-12 TGF-β IL-8 TNF-α 18srRNA
Forward primer GGTACATCCTCGACGGCATCT GACTCCATCTTGGCTGTGA TCAAACCAGACCCACCGAA CCCAGCATCTGCAAAGCTC GAGAGTGATTGAGAGTGGACCAC CCGAGGCAGTCAGATCATCTT GTAACCCGTTGAACCCCATT
Length 21 19 19 19 23 21 20
Reverse primer GTGCCTCTTTGCTGCTTTCAC TGATTTCTGCTCTGACAACCT GCTGACCTCCACCTGCTGA GTCAATGTACAGCTGCCGCA CACAACCCTCTGCACCCAGTTT AGCTGCCCCTCAGCTTGA CCATCCAATCGGTAGTAGCG
Length 21 21 19 20 22 18 20
product length 81 103 68 101 112 85 152
Annealing temperature 59 56 58 59 59 58 56

Statistical Analysis

The sample size was calculated according to the ratio of positive markers in both groups, and taking into account 5% and 20% of the first and second types of errors respectively.
The results were analyzed using SPSS Version 20, and the mean and standard deviations were also calculated. The paired t-test was used to analyze the difference or correlation between gene expression levels and Clinicopathologic Features. The difference was considered significant at P≤0.05.

 
 

Results

This study included 30 patients with COVID-19, who were admitted to the ICU due to severe symptoms, as well as 30 people who the result of their CORONA test was positive, and had mild-moderate symptoms, and were hospitalized in the infectious-internal medicine wards.
The group of patients with severe symptoms consisted of 21 males and 9 females, and the group of patients with mild symptoms consisted of 20 males and 10 females. There was no significant difference between two groups in terms of average age (Table. 2). Patients with severe and mild symptoms were tested for LDH and showed a significant increase in the mean serum levels of LDH in the ICU patients compared to the ward group (P= 0.003). The serum levels of CRP, vitamin D3, and hemoglobin showed no significant difference between two groups (Fig. 1 and Table 2). In the ICU patients the mean number of WBCs (P<0.001) and neutrophils (P= 0.004) were significantly increased compared to the ward group. However, the mean numbers of lymphocytes were significantly decreased in the ICU patients compared to the ward group (P= 0.001).

 Table 2. Laboratory data diagrams information of patients with COVID-19 stratified by two clinical types

  group N Mean Std. Deviation P -value
Age Ward 30 53.4667 16.48141 0.875
ICU 30 54.2333 16.26225
LDH Ward 30 443.2593 201.78465 0.003
 
ICU 30 969.3077 866.75716
WBC Ward 30 6.8817 2.42745 0.000
ICU 30 11.3523 5.97583
Hg Ward 30 13.8833 1.69443 0.161
ICU 30 13.1333 2.34864
Neutrophil Ward 30 64.8333 12.85753 0.004
ICU 30 75.2667 14.36455
Lymphocyte Ward 30 25.4000 10.09814 0.001
ICU 30 16.3000 10.43915
CRP Ward 30 0.3571 0.49725 0.120
ICU 30 0.1176 0.33211
VitD3 Ward 30 26.8333 15.05213  
0.450
ICU 30 41.8000 43.78584


Figure 1. Laboratory data diagrams in severe and mild COVID-19 cases.
Figure 1. Laboratory data diagrams in severe and mild COVID-19 cases.

 

The Analysis of the Cytokines Expression

The relative expression of each gene varies in different patients. Evaluating the specific peak of the studied product can ensure that Real-time PCR is unique.
IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α markers in the peripheral blood of patients with severe symptoms, were positive on 28/30 (93.33%), 27/30 (90%), 24/30 (80%), 25/30 (83.33%), 26/30 (86.66%), and 27/30 (90%) respectively. The positive rate of these markers in the group of patients with mild symptoms was 20/30 (66.67%), 21/30 (70%), 18/30 (60%), 17/30 (56.67%), 19/30 (63.33%), 18/30 (60%), respectively. The statistical comparison of the positivity of these markers in both groups was performed using the two-sample binomial test, which showed that there was a statistically significant difference between these two groups (P< 0.001) (Fig. 2). The obtained data from gene expression levels showed that the relative expression level of IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α cytokines in the group of patients with severe symptoms versus the ward group were 1.08, 1.14, 1.09, 1.10, 1.22, and 1.12, respectively (Fig. 3).


Figure 2. The rate of positive cytokines in patients with severe and mild symptoms.
Figure 2. The rate of positive cytokines in patients with severe and mild symptoms.
 
Figure 3. The difference between cytokine expressions in patients with severe symptoms compared to patients with mild symptoms. 
Figure 3. The difference between cytokine expressions in patients with severe symptoms compared to patients with mild symptoms.

 
 

Discussion

Cytokines are low molecular weight proteins or glycoproteins. These compounds can be considered as immune system hormones and inflammatory responses (20, 21). Cytokines, in general, affect the activity, differentiation, amplification, and survival of immune cells, as well as regulate the production and activity of other cytokines, which can increase (pre-inflammatory cytokines) or decrease (anti-inflammatory cytokines) the inflammatory response (21).
In the event of injury or infection in an organ or limb, an immune response is formed to suppress the infection, in which the release of pre-inflammatory cytokines during inflammation indicates the body's attempt to respond to the infection (22). There is a dynamic and changeable balance in two directions, between pre-inflammatory cytokines and anti-inflammatory compounds of the immune system. Any change in this balance will lead to dangerous effects on the individual (21, 23-25).
A number of cytokines play an important role in causing acute inflammation (26). The development of the disease is strongly related to the expression level of inflammatory cytokines and chemokines (27-30). Various cytokines and innate immune cells have been associated with immunopathology in coronavirus (31-33).
This study examined the expression of several cytokine genes in patients with COVID-19 in a group with severe clinical symptoms and admitted to ICU, compared with the group with mild clinical symptoms hospitalized in the infectious-internal medicine wards and Real-time PCR technique is used in it. The technique has good sensitivity to molecular evaluations.
Several studies have shown that unregulated and excessive immune responses may lead to immunopathology and fatal disease in the patient (34, 35). It is believed that host immune responses play a major role in the complications of diseases caused by SARS-CoV and MERS-CoV infections (36).
In our study, using Ct values obtained from real-time PCR reactions and performed calculations, the increase of cytokine genes expression in patients admitted to the ICU with severe symptoms were shown compared with patients with mild symptoms admitted to infectious wards.
According to a report in Lancet, ARDS is the main cause of mortality in patients with Covid-19 (37). Several pre-inflammatory cytokines such as IL-8 and IL-1β, are involved in the pathogenesis of ARDS (38). ARDS is considered the main cause of mortality in patients with SARS-CoV or MERS-CoV (38).
One of the main mechanisms for ARDS is the Cytokine storm, which is, in fact, an uncontrolled systemic inflammatory response that causes death, which is due to release large amounts of pre-inflammatory cytokines such as IFN-a, IFN-g, IL-1b, IL-6, IL- 12, IL-18, IL-33, TNF-a, TGFb, etc (11, 39).
The study of C.K. Min et al. demonstrated that people with severe MERS-CoV infections, as those with SARS-CoV, reveal higher serum levels of IL-6, IFN-a, CCL5, CXCL8, and CXCL-10 compared to those with the mild disease (12). In our study, an increase in the cytokines expression of IL-6, IFN-α, IL-12, TGF-β, IL-8, and TNF-α was observed in the peripheral blood of patients with severe symptoms compared with patients with mild symptoms.
In the study of Bandar Alosaimi et al. (2019), an increased inflammatory response was reported in patients with severe MERS-CoV infection that sometimes progressed to cause ARDS, which is in line with the present study, in which increased expression of inflammatory cytokines in patients with Severe COVID-19 was shown (40).
The evidence of performed studies on SARS and respiratory syncytial virus (HRSV) has shown that there has been an increase in IL-8 with acute SARS infection, bronchiolitis, immunopathology, and disease enhancement during infection HRSV (41). In a recent study, IL-8 also has shown an increase in severe cases.


 

Conclusion

In general, coronavirus infection, which affects human lungs, lead to inflammatory reactions in the human body, and the immune cells release a large amount of pre-inflammatory, inflammatory and anti-inflammatory cytokines that are called cytokine storms and these reactions cause serious complications and injuries in patients. It seems that in patients with more severe complications, who are admitted to the ICU, release of inflammatory cytokines, is more than patients with milder symptoms. The present study also showed an increase of IL-6, IFN-α, IL-12, TLF-β, IG-8 and TNF-α cytokine gene expression in the peripheral blood of patients with severe symptoms compared to patients with mild symptoms, which as a result of increasing the expression of these genes, the cytokines are produced and enter the bloodstream, causing inflammatory and even destructive reactions at their target sites.
It should be noted that the disease caused by the coronavirus (COVID-19), is a new disease, and in order to achieve more complete and comprehensive results, more research is needed for better diagnoses and treatments.


 

Ethical Approval

This study was approved by University ethical Committee (Ethical Code: IR.SBMU.NRITLD.REC. 1399.042) and all patients filled out an informed consent form.
 

 

Acknowledgment

This research is a part of the efforts of the professors and colleagues of Masih Daneshvari Hospital of Shahid Beheshti University of Medical Sciences. All involved are sincerely thanked.
 
 

Funding

None.

 

Conflicts of Interest

There is no conflict of interest between the authors.


 

Type of Study: Original Research Article | Subject: Medical Virology
Received: 2022/07/1 | Accepted: 2022/07/17 | ePublished: 2022/08/8

References
1. Lamb LE, Bartolone SN, Ward E, Chancellor MB. Rapid Detection of Novel Coronavirus (COVID19) by Reverse Transcription-Loop-Mediated Isothermal Amplification. MedRxiv. 2020. [DOI:10.2139/ssrn.3539654]
2. Shi Z, Hu Z. A review of studies on animal reservoirs of the SARS coronavirus. Virus Res. 2008;133(1): 74-87. [DOI:10.1016/j.virusres.2007.03.012] [PMID] [PMCID]
3. Dariushnejad H, Ghorbanzadeh V, Akbari S, Hashemzadeh P. Designing a Multi-epitope Peptide Vaccine Against COVID-19 Variants Utilizing In-silico Tools. Iran J Med Microbiol. 2021; 15(5):592-605. [DOI:10.30699/ijmm.15.5.592]
4. Abdollahi A, Mahmoudi-Aliabadi M, Mehrtash V, Jafarzadeh B, Salehi M. The novel coronavirus SARS-CoV-2 vulnerability association with ABO/Rh blood types. Iran J Pathol. 2020;15(3):156-60. [DOI:10.30699/ijp.2020.125135.2367] [PMID] [PMCID]
5. De Wit E, Van Doremalen N, Falzarano D, Munster VJ. SARS and MERS: recent insights into emerging coronaviruses. Nat Rev Microbiol. 2016;14(8):523-4. [DOI:10.1038/nrmicro.2016.81] [PMID] [PMCID]
6. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497-506. [DOI:10.1016/S0140-6736(20)30183-5]
7. Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y, et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. Lancet. 2020; 395(10223):507-13. [DOI:10.1016/S0140-6736(20)30211-7]
8. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA. 2020;323(11):1061-9. [DOI:10.1001/jama.2020.1585] [PMID] [PMCID]
9. Hui RK, Zeng F, Chan CM, Yuen K, Peiris JS, Leung FC. Reverse transcriptase PCR diagnostic assay for the coronavirus associated with severe acute respiratory syndrome. J Clin Microbiol. 2004;42 (5):1994-9. [DOI:10.1128/JCM.42.5.1994-1999.2004] [PMID] [PMCID]
10. Peiris M, Guan Y, Yuen K. Severe acute respiratory syndrome: Wiley Online Library; 2005. [DOI:10.1002/9780470755952]
11. Williams AE, Chambers RC. The mercurial nature of neutrophils: still an enigma in ARDS?. Am J Physiol Lung Cell Mol Physiol. 2014;306(3):L217-L30. [DOI:10.1152/ajplung.00311.2013] [PMID] [PMCID]
12. Min C-K, Cheon S, Ha N-Y, Sohn KM, Kim Y, Aigerim A, et al. Comparative and kinetic analysis of viral shedding and immunological responses in MERS patients representing a broad spectrum of disease severity. Sci Rep. 2016;6(1):1-12. [DOI:10.1038/srep25359] [PMID] [PMCID]
13. To KK-W, Tsang OT-Y, Yip CC-Y, Chan K-H, Wu T-C, Chan JM-C, et al. Consistent detection of 2019 novel coronavirus in saliva. Clin Infect Dis. 2020; 71(15):841-3. [DOI:10.1093/cid/ciaa149] [PMID] [PMCID]
14. Heydar H, Mansouri K, Norooznezhad M, Norooznezhad F, Mohamadnia A, Bahrami N. Bevacizumab Inhibits Angiogenic Cytokines in Head and Neck Squamous Cell Carcinoma: From Gene to the Protein. Int J Hematol-Oncol Stem Cell Res. 2018;12(2):136-41.
15. Karimi S, Bahrami N, Sharifi K, Daustany M, Baghbani-Arani F, Kazempour M, et al. Investigating gene expression level of MUC1 and CEA in pleural fluid of NSCLC lung cancer patients with real-time RT-PCR method. Minerva Pneumol. 2017;56(1):18-24. [DOI:10.23736/S0026-4954.16.01772-7]
16. Bahrami N, Gholami M, Jamaati HR, Mohamadnia A, Dargahi H, Kazempour Dizaji M, et al. Expression of two essential mRNA biomarker in the peripheral blood as possible biomarkers for diagnosis of non-small cell lung carcinoma. Minerva Pneumol. 2016;55(3):31-6.
17. Ghadimi K, Bahrami N, Fathi M, Farzanegan B, Naji T, Emami M, et al. Diagnostic value of LunX mRNA and CEA mRNA expression in pleural fluid of patients with non-small cell lung cancer. Minerva Pneumol. 2017;56(2):90-5. [DOI:10.23736/S0026-4954.16.01773-9]
18. Farzanegan B, Bahrami N, Birjandi B, Khosravi A, Nasab AF, Fathi M, et al. Down-Expression of miRNA-98 and Over-Expression of miRNA-9 Can Result in Inadequate Immune System Response against Lung Cancer. Biointerface Res Appl Chem. 2021;11(6):13893-902. [DOI:10.33263/BRIAC116.1389313902]
19. Bolandparva F, Nasab MSH, Mohamadnia A, Garajei A, Nasab AF, Bahrami N. Early Diagnosis of Oral Squamous Cell Carcinoma (OSCC) by miR-138 and miR-424-5p Expression as a Cancer Marker. Asian Pac J Cancer Prev. 2021;22(7):2185-9. [DOI:10.31557/APJCP.2021.22.7.2185] [PMID] [PMCID]
20. Ozaki K, Leonard WJ. Cytokine and Cytokine Receptor Pleiotropy and Redundancy. J Biol Chem. 2002;277(33):29355-8. [DOI:10.1074/jbc.R200003200] [PMID]
21. Dinarello CA. Historical insights into cytokines. Eur J Immunol. 2007;37(S1):S34-S45. [DOI:10.1002/eji.200737772] [PMID] [PMCID]
22. Scarpioni R, Ricardi M, Albertazzi V. Secondary amyloidosis in autoinflammatory diseases and the role of inflammation in renal damage. World J Nephrol. 2016;5(1):66-75. [DOI:10.5527/wjn.v5.i1.66] [PMID] [PMCID]
23. Opal SM, DePalo VA. Anti-inflammatory cytokines. Chest. 2000;117(4):1162-72. [DOI:10.1378/chest.117.4.1162] [PMID]
24. Zinchuk A, Holubovska O, Shkurba A, Hrytsko R, Vorozhbyt O, Richniak M, et al. Original inhibition method of excessive synthesis of pro-inflammatory cytokine of tumour necrosis factor α. Central-Eur J Immunol. 2015;40(3):345-8. [DOI:10.5114/ceji.2015.54597] [PMID] [PMCID]
25. Arend WP. The mode of action of cytokine inhibitors. J Rheumatol Suppl. 2002;65:16-21.
26. Shaikh PZ. Cytokines & their physiologic and pharmacologic functions in inflammation: A review. Int J Pharm & Life Sci. 2011;2(11):1274-63.
27. Zhang Y, Li J, Zhan Y, Wu L, Yu X, Zhang W, et al. Analysis of Serum Cytokines in Patients with Severe Acute Respiratory Syndrome. Infect Immun. 2004;72(8):4410-5. [DOI:10.1128/IAI.72.8.4410-4415.2004] [PMID] [PMCID]
28. De Jong MD, Simmons CP, Thanh TT, Hien VM, Smith GJ, Chau TNB, et al. Fatal outcome of human influenza A (H5N1) is associated with high viral load and hypercytokinemia. Nat Med. 2006;12 (10):1203-7. [DOI:10.1038/nm1477] [PMID] [PMCID]
29. Cillóniz C, Shinya K, Peng X, Korth MJ, Proll SC, Aicher LD, et al. Lethal Influenza Virus Infection in Macaques Is Associated with Early Dysregulation of Inflammatory Related Genes. PLoS Pathog. 2009;5(10):e1000604. [DOI:10.1371/journal.ppat.1000604] [PMID] [PMCID]
30. Tavakoli-Ardakani M, Abbaspour H, Nasab AF, Meibodi AM, Kheradmand A. Study of the Effect of Memantine on Negative Sign in Patients with Schizophrenia and Schizoaffective Disorders. Iran J Pharma Res. 2018;17(Suppl):122-9.
31. Channappanavar R, Perlman S. Pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology. Semin Immunopathol. 2017;39(5):529-39. Springer: Berlin Heidelberg. [DOI:10.1007/s00281-017-0629-x] [PMID] [PMCID]
32. Teijaro JR. Cytokine storms in infectious diseases. Semin Immunopathol; 2017;39(5):501-3. Springer: Berlin Heidelberg. [DOI:10.1007/s00281-017-0640-2] [PMID] [PMCID]
33. Xi-zhi JG, Thomas PG. New fronts emerge in the influenza cytokine storm. Semin Immunopathol. 2017;39(5):541-50. Springer: Berlin Heidelberg. [DOI:10.1007/s00281-017-0636-y] [PMID] [PMCID]
34. Channappanavar R, Fehr AR, Vijay R, Mack M, Zhao J, Meyerholz DK, et al. Dysregulated Type I Interferon and Inflammatory Monocyte-Macrophage Responses Cause Lethal Pneumonia in SARS-CoV-Infected Mice. Cell Host Microbe. 2016;19(2):181-93. [DOI:10.1016/j.chom.2016.01.007] [PMID] [PMCID]
35. Shaw AC, Goldstein DR, Montgomery RR. Age-dependent dysregulation of innate immunity. Nat Rev Immunol. 2013;13(12):875-87. [DOI:10.1038/nri3547] [PMID] [PMCID]
36. Davidson S, Maini MK, Wack A. Disease-Promoting Effects of Type I Interferons in Viral, Bacterial, and Coinfections. J Interferon Cytokine Res. 2015;35 (4):252-64. [DOI:10.1089/jir.2014.0227] [PMID] [PMCID]
37. Li X, Geng M, Peng Y, Meng L, Lu S. Molecular immune pathogenesis and diagnosis of COVID-19. J Pharm Anal. 2020;10(2):102-8. [DOI:10.1016/j.jpha.2020.03.001] [PMID] [PMCID]
38. Cheng OZ, Palaniyar N. NET balancing: a problem in inflammatory lung diseases. Front Immunol. 2013;4:1. [DOI:10.3389/fimmu.2013.00001]
39. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579 (7798):265-9. [DOI:10.1038/s41586-020-2008-3] [PMID] [PMCID]
40. Alosaimi B, Hamed ME, Naeem A, Alsharef AA, AlQahtani SY, AlDosari KM, et al. MERS-CoV infection is associated with downregulation of genes encoding Th1 and Th2 cytokines/ chemokines and elevated inflammatory innate immune response in the lower respiratory tract. Cytokine. 2020;126:154895. [DOI:10.1016/j.cyto.2019.154895] [PMID] [PMCID]
41. Lau SK, Lau CC, Chan K-H, Li CP, Chen H, Jin D-Y, et al. Delayed induction of proinflammatory cytokines and suppression of innate antiviral response by the novel Middle East respiratory syndrome coronavirus: implications for pathogenesis and treatment. J Gen Virol. 2013;94 (12):2679-90. [DOI:10.1099/vir.0.055533-0] [PMID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc