year 15, Issue 4 (July - August 2021)                   Iran J Med Microbiol 2021, 15(4): 458-464 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Roshdi Maleki M, Taghinejad J. Prevalence of Extended-spectrum Beta-lactamases (ESBL) Types blaTEM and blaSHV in Klebsiella pneumoniae Strains Isolated from Clinical Samples by PCR in Miandoab, West Azerbaijan. Iran J Med Microbiol 2021; 15 (4) :458-464
URL: http://ijmm.ir/article-1-1316-en.html
1- Department of Microbiology, Malekan Branch, Islamic Azad University, Malekan, Iran , mehdiroshdi@gmail.com
2- Department of Microbiology, Malekan Branch, Islamic Azad University, Malekan, Iran
Full-Text [PDF 523 kb]   (1799 Downloads)     |   Abstract (HTML)  (4409 Views)
Full-Text:   (2334 Views)
Introduction


In 1882, Carl Friedlander described Klebsiella pneumoniae for the first time. He described it as an encapsulated bacillus after isolating the bacterium from the lungs of those who had died from pneu-monia. (1). Klebsiella spp causes a wide range of heal-thcare-related infections, including pneumonia, urina-ry tract infections (UTIs), bloodstream infections, wou-nd or surgery infections, and sepsis (2, 3). It is, there-fore, not surprising to state that this pathogen has been identified by several organizations as an "immediate threat to human health" (4). Dispropor-tionate and wrong use of antibiotics leads to the rapid expansion of antibiotic-resistant bacteria and antibio-tic resistance genes (5, 6). K. pneumoniae has undoub-tedly become the most common pathogenic bacter-ium in nosocomial infections due to its high virulence factor and general resistance to most antibiotics (7). 
blaTEM and blaSHV are the 2 main types of ESBL genes. blaTEM (found and isolated in the early 80s from Teminora who was a Greek patient), and blaSHV (for a variable sulphydryl which was first observed in a single Klebsiella ozaenae strain retrieved in Germany). These genes which are mediated by transposons, plasmids, or chromosomes are all sporadically described all over the world. Nowadays as one of the most mechanisms of resistance against beta-lactam antibiotics, it is considered amongst gram-negative bacteria (8). Beta-lactamase SHV was first discovered in 1972 by Pitton namely PIT-2. Later, because of its sulfhydryl, the name of SHV was replaced. The SHV precursor gene probably appears as a chromosomal gene in Klebsiella strains that is genetically transmitted to the plasmid and then spread in its way to other Enterobacteria-ceae spp (9).
Many beta-lactamases are transported by mobile genetic elements such as plasmids, transposons, and integrons, resulting in the widespread diffusion of resistance factors from one bacterial strain to another. Therefore, identification of this type of antibiotic resistance gene is very important to implement infec-tion control programs and prevent the spread of resis-tant strains. Because K. pneumoniae is the most com-mon bacterium producing ESBLs, the major aim of this study was to determine the frequency of blaTEM and blaSHV types in K. pneumoniae strains isolated from clinical specimens in Miandoab by using PCR.

 

 

Materials and Methods

Collection and identification of bacterial isolates:

This descriptive-analytical cross-sectional study was conducted during 8 months from April to December 2019. A total of 120 bacterial isolates of K. pneumo-niae were collected from clinical specimens in infect-ious wards of Miandoab hospitals. These specimens were examined considering blaTEM and blaSHV produc-tion after they were confirmed by implementing bio-chemical tests.

Antibiotic susceptibility test:

Turbidity equivalent to 0.5 McFarland was obtained from K. pneumoniae colonies and then an antibiogram was performed by disk diffusion agar or Kirby-Bauer method to determine the patterns of antibiotic susceptibility of the isolates in Müller-Hinton agar (MHA) medium (10). Antibiotic susceptibility to 9 anti-biotic discs including gentamicin (10 μg), cotrimoxa-zole (1.25 μg), nalidixic acid (30 μg), ciprofloxacin (5 μg), cefepime (30 μg), cefotaxime (30 μg), imipenem (10 μg), ceftazidime (30 μg), amoxicillin (30 μg) pre-pared from Padtan Teb Company and the sensitivity or resistance to antibiotics was verified according to the standard Clinical and Laboratory Standards Institute (CLSI) method (11).
To isolate ESBL producing strains, the combined disk method was used (12). Isolated strains were cultured on MHA and cefotaxime disk (30 μg) versus cefota-xime-clavulanic acid disk (30 μg/10 μg), ceftazidime disk (30 μg) versus ceftazidime-clavulanic acid (30 μg/10 μg), also the cefepime disk (30 μg) were placed in front of the cefepime-clavulanic acid disk (30 μg/10 μg) (Mast company) at a distance of 30 mm from each other. After incubating for 24 hours at 37 °C, the production of ESBLs was identified by measuring the diameter of the zone of inhibition (ZOI), which was demonstrated to be 5 mm or more, considering the combined disks (antibiotics with clavulanic acid) and concerning the single antibiotic discs.

DNA extraction and molecular analysis:

DNA extraction was performed by boiling method (13). For this purpose, a loop of the bacterial colony was transferred to a sterile micro tube containing 300 μl of sterile TE (1X) buffer and boiled for 10 min at 100 °C. At that time, it was centrifuged at 13,000 ×g for 10 min. After that, it was transferred from the supernat-ant to another micro tube for PCR. PCR reactions were performed for each sample in volumes of 25 μl using a thermal cycler with a temperature gradient (Eppend-orf, Germany) and primers of Takapo Zist Company (Iran). The composition and schedule of PCR are sho-wn in Tables 1 and 2. Analysis of 3 μl of the PCR prod-ucts (amplicon) was performed by electrophoresis on 1.5% gel agarose. After electrophoresis and gel stain-ing with GelRed™ DNA stains, the fragments were visualized under UV light in the gel documentation system (Gel Doc, ATP Co).
 

 
Table 1. Primer sets for amplification of the blaTEM and blaSHV genes and PCR reactions

Gene Primer (5ʹ-3ʹ) Amplicon size (bp) PCR Volume
 (25 µL)
Ref
blaTEM F: ATGCACCACCTGCACACAGG
R: GGTGGTTTGTCGCGTTGTTC
861 Taq DNA Polymerase 2x Master Mix MgCl2 4 mM (12.5 µL), Template DNA (variable), Forward and Reverse primer (0.5 µL for each), Nuclease-free water (10.5 µl) (8)
blaSHV F: TCAGCGAAAAACACCTTG
R: TCCCGCAGATAAATCACCA
475

 

Table 2. PCR program. 

Steps Temperature (ºC) Time Number of Cycles
Initial denaturation 95 4 min 1
Denaturation 94 30 sec 35
Annealing 60 30 sec
Extension 72 60 sec
Final extension 72 10 min 1

 
 

Results

Antibiotic susceptibility test:

The results of the evaluation of antibiotic suscepti-bility testing of K. pneumoniae strains which were isolated from clinical specimens are presented in Table 3. In the antibiogram test by disk diffusion met-hod, from 120 isolates of K. pneumoniae, the highest resistance were detected to cefotaxime, amoxicillin, nalidixic acid, and cotrimoxazole. Moreover, an extr-eme sensitivity was found against imipenem, ciproflo-xacin, ceftazidime, and cefepime.
In the combined disk method, of 120 strains of K. pneumoniae, 71 (59.17%) were positive for ESBL. In this method, if the diameter of the ZOI around the disk was 5 mm or more, it was considered as positive ESBL.
 

Table 3. Antibiogram test results.

Antibiotic Sensitive Intermediate Resistant
Number Percentage Number Percentage Number Percentage
Amoxicillin 56 46.67 - - 64 53.33
Imipenem 83 69.17 7 5.83 30 25
Ceftazidime 60 50 5 4.17 55 45.83
Cefotaxime 50 41.67 5 4.17 65 54.17
Ciprofloxacin 69 57.50 11 9.2 40 33.33
Co-trimoxazole 50 41.67 10 8.33 60 50
Nalidixic acid 53 44.17 5 4.17 62 51.66
Gentamicin 55 45.83 15 12.50 50 41.67
Cefepime 58 48.34 16 13.33 46 38.33

 

PCR amplification of blaTEM and blaSHV genes

The presence of blaTEM in the isolates was almost slightly higher than blaSHV (Table 4). While the percen-tage of the presence of both genes in an isolate was minimum (7%). The images of the electrophoresis test are presented in Figure 1.

 Figure 1. Electrophoresis results of PCR products. A) blaTEM, B) blaSHV, M: DNA ladder (100 bp).
Figure 1. Electrophoresis results of PCR products. A) blaTEM, B) blaSHV, M: DNA ladder (100 bp).


Table 4. Frequency of studied genes based on PCR results.

Genotype Abundance (%)
blaTEM 35 (49.30)
blaSHV 31 (43.70)
blaTEM + blaSHV 5 (7)
Total 71 (100)


 

Discussion

It is critically important to be aware of the trend of regional antimicrobial resistance among clinical iso-lates to make evidence-based recommendations and implement infection control programs and prevent the spread of resistant strains. In this study, the most resistance antibiotics to K. pneumoniae isolates were cefotaxime, amoxicillin, nalidixic acid and cotrimoxa-zole. The obtained results are consistent with several studies (14-16). This may be due to the publicity and familiarity of these drugs as well as their availability and utility. In the present study, imipenem from carba-penems, ciprofloxacin from fluoroquinolones, ceftaz-idime and cefepime from the 3rd and 4th generation cephalosporins were active and effective antimicr-obial agents against isolated strains of K. pneumoniae, respectively. In a study conducted by Talebi et al. (16), the lowest resistance was reported to imipenem, which is consistent with the results of the current study. In this study, after imipenem, ciprofloxacin with 57.50% was the most effective drug against K. pneumoniae, which is consistent with the results of Mobin et al. (14), Ghane et al. (15) and Talebi et al. (16) investigations. The results were not in accordance with Archin et al. (17) and Derakhshan et al. (18) studies, which confirmed that more than 98% of Klebsiella strains showed sensitivity to imipenem. In recent years, ESBL-producing bacteria, especially K. pneumoniae, have emerged as a serious pathogen in hospitals and the community, causing various infect-ions such as pneumonia, urinary tract infections (UTIs), and bloodstream infections (2, 4, 7). The incide-nce of the ESBL in the specimens of clinical isolates is extremely different throughout the world and is rapidly changing over time. In this study, it was found that ESBL phenotype was observed to be positive in 71 isolates (59.17%). Similar results have been reported in various countries such as Sudan (19), Iran (20), India (21) and Turkey (22). However, the results of the present study are more valuable than the similar studies conducted in Germany (23), Switzerland (24) and Saudi Arabia (25). On the other hand, other studies in China (26), Nigeria (27) and India (28) showed that the results considering the prevalence of K. pneumoniae-causing strains of ESBL are different from the outcomes of the present study.
In this study, imipenem with 69.17% was identified as the most effective drug against K. pneumoniae in vitro. Imipenem has also been introduced as an effective antibiotic in the treatment of K. pneumoniae in Ishii et al. (29) in Japan, Bratu et al. (30) in the United States, Soltan Dalal Mohammad et al. (31) in Iran, Amin et al. (32) in Jordan, Al-shara et al. (33) in Saudi Arabia and Tawfik et al. (34).
Molecular studies showed that blaTEM and blaSHV genes were present in ESBL-producing strains with 49.30% and 43.70% frequency, respectively. In the study of Feizabadi et al. (35), the prevalence of the above genes in K. pneumoniae strains were 54% and 67.4%, which contradicts the results of the present study. The frequency of the bla TEM gene in K. pneumoniae strains studied by Archin et al. (17) in Shiraz, Iran was 38.34%. Likewise, the frequency of blaTEM and blaSHV genes in K. pneumoniae strains performed by Ghane et al. (15) in Tehran, Iran were reported to be 41.5% and 10.7%, respectively. In Ranj-bar et al. (36) study, the prevalence of blaTEM and bla-SHV genes in K. pneumoniae strains were 41.9% and 54.8%. The frequency of the blaSHV gene in their study was higher than the results of the current study. In a comprehensive study conducted in Pakistan by Samyyi et al. (37) in 2019, the frequency distribution of blaCTX-M, blaTEM, blaSHV genes in E. coli, K. pneumoniae, P. aer-uginosa and Acinetobacter baumannii was examined. In their study, the frequency of blaCTX-M, blaTEM, blaSHV genes in K. pneumoniae were 67%, 34% and 89% respectively.
The frequency of these genes in K. pneumoniae were 67%, 34%, and 89%, in turn. The prevalence of these genes in Doha, Qatar has been reported by Sid Ahmed et al. (38) as 53.2%, 40.4% and 64.1%.
Effendi et al. (2018) examined the presence of blaTEM gene as well as drug resistance in K. pneumoniae isolates by sampling some foods such as beef, chicken, and fish. The researchers report that the highest drug resistance was to amoxicillin and that 9 of the 10 isolates identified had the blaTEM gene (39). Ugbo et al. (2020) also studied 267 bacterial isolates of E. coli and K. pneumoniae from patients with wound and urinary tract infections to evaluate antibiotic resistance and identify beta-lactamase genes. Similarly, of 89 isolates producing beta-lactamase, 5 strains were K. pneumo-niae and the prevalence of blaTEM and blaSHV genes in both bacteria were 55% and 35% (40). Zhong et al. (2020), likewise, described that of 465 fecal samples examined, about 66% of healthy adults carry K. pneu-moniae. Furthermore, the frequency of blaTEM and bla-SHV genes were 66.27% and 17.02%, sequentially (41).
The comparison of the results of various studies shows that the prevalence of blaTEM and blaSHV genes in K. pneumoniae strains isolated from clinical speci-mens in different countries and within a country varies from region to region. This may be due to differences in antibiotic protocols or host genetic diversity in each region.


 

Conclusion

The blaTEM and blaSHV were highly prevalent in ESBL isolates, and these enzymes played an important role in resistance to beta-lactam antibiotics. Moreover, comparing the results of the present study with studies conducted in other countries as well as different regions in Iran indicated that the prevalence of drug-resistant and ESBL-producing strains varies in different regions. This was dependent on the infection control system in the area and how patients were treated. Generally, imipenem is known in most countries as an effective drug in the treatment of infections caused by K. pneumoniae strains.


 

Acknowledgements

None.


 

Conflicts of Interest

The authors declared no conflict of interests.


 

Type of Study: Original Research Article | Subject: Medical Bacteriology
Received: 2021/04/12 | Accepted: 2021/07/18 | ePublished: 2021/08/16

References
1. Friedländer C. Ueber die Schizomyceten bei der acuten fibrösen Pneumonie. Archiv für pathologische Anatomie und Physiologie und für klinische Medicin. 1882;87(2):319-24. [DOI:10.1007/BF01880516]
2. Paczosa MK, Mecsas J. Klebsiella pneumoniae: Going on the Offense with a Strong Defense. Microbiol Mol Biol Rev. 2016;80(3):629-61. [DOI:10.1128/MMBR.00078-15]
3. Tehrani FHE, Moradi M, Ghorbani N. Bacterial Etiology and Antibiotic Resistance Patterns in Neonatal Sepsis in Tehran during 2006-2014. Iranian journal of pathology. 2017;12(4):356. [DOI:10.30699/ijp.2017.27992]
4. Bengoechea JA, Sa Pessoa J. Klebsiella pneumoniae infection biology: living to counteract host defences. FEMS Microbiol Rev. 2019;43(2):123-44. [DOI:10.1093/femsre/fuy043]
5. Taghinejad J, Barati B, Sadeghi A. A study of the drug resistance pattern of Group B Streptococcus isolated from urinary samples in the city of Salmas during the year 2015. New Cellular and Molecular Biotechnology Journal. 2018;8(30):79-84.
6. Mehdi RM, Javid T, Hossein MA. Drug susceptibility of E. coli strains isolated from patients with UTI by disc diffusion agar method in Salmas city of Iran. HealthMED.1146.
7. Wei J, Wenjie Y, Ping L, Na W, Haixia R, Xuequn Z. Antibiotic resistance of Klebsiella pneumoniae through β-arrestin recruitment-induced β-lactamase signaling pathway. Experimental and therapeutic medicine. 2018;15(3):2247-54. [DOI:10.3892/etm.2018.5728]
8. Zaniani FR, Meshkat Z, Nasab MN, Khaje-Karamadini M, Ghazvini K, Rezaee A, et al. The prevalence of TEM and SHV genes among extended-spectrum beta-lactamases producing Escherichia coli and Klebsiella pneumoniae. Iranian journal of basic medical sciences. 2012;15(1):654.
9. Chaves J, Ladona MG, Segura C, Coira A, Reig R, Ampurdanés C. SHV-1 β-lactamase is mainly a chromosomally encoded species-specific enzyme in Klebsiella pneumoniae. Antimicrobial agents and chemotherapy. 2001;45(10):2856-61. [DOI:10.1128/AAC.45.10.2856-2861.2001]
10. Hudzicki J. Kirby-Bauer disk diffusion susceptibility test protocol. American Society for Microbiology. 2009.
11. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th Edition. CLSI standard M02 Wayne, PA: Clinical and Laboratory Standards Institute. 2018.
12. Wadekar MD, Anuradha K, Venkatesha D. Phenotypic detection of ESBL and MBL in clinical isolates of Enterobacteriaceae. Int J Curr Res Aca Rev. 2013;1(3):89-95.
13. Ahmed OB, Dablool A. Quality improvement of the DNA extracted by boiling method in gram negative bacteria. International Journal of Bioassays. 2017;6(4). [DOI:10.21746/ijbio.2017.04.004]
14. Mobin H, Nahaie MR, Amir mozafari N, Sadeghi J, M R. Enterobacteriaceae producing Extended-spectrum beta-lactamases (ESBL) and plasmid patterns in intensive care unit of children's hospital in Tabriz. Med J Tabriz Univ Med Sci. 2007;28:95-101.
15. Soroush Z, Ghane M. Molecular identification of CTX-M, TEM and SHV β-lactamases in â Klebsiella pneumoniae isolated from respiratory system of patients in the ICU of educational hospitals in Tehran. Feyz Journal of Kashan University of Medical Sciences. 2017;21(3):232-9.
16. Talebi TM, Golestanpour A. Symptomatic nosocomial urinary tract infection in ICU patients: identification of antimicrobial resistance pattern. 2009.
17. Archin T, Afzalian E, Kargar M, Y G. β lactamases genes and antibiotics resistance pattern of K. pneumoniae isolates collected from ICU patients of Namazi Hospital, Shiraz, Iran. Armaghan-e-Danesh. 2014;18(10):816-25.
18. Derakhshan S, Najar peerayeh F, Fallah F, Bakhshi B, Rahbar M, M. M-Z. Identification of expended spectrum betalactamase producing Klebsiella pneumonia isolated from intensive care unit (ICU) patiants in three hospitals in Iran. Infect Epidemiol Med. 2013;1(1):9-13.
19. Ahmed OB, Omar AO, Asghar AH, Elhassan MM, Al-Munawwarah A-M, Arabia S. Prevalence of TEM, SHV and CTX-M genes in Escherichia coli and Klebsiella spp Urinary Isolates from Sudan with confirmed ESBL phenotype. Life Sci J. 2013;10(2):191-5.
20. Ghafourian S, bin Sekawi Z, Sadeghifard N, Mohebi R, Neela VK, Maleki A, et al. The prevalence of ESBLs producing Klebsiella pneumoniae isolates in some major hospitals, Iran. The open microbiology journal. 2011;5:91. [DOI:10.2174/1874285801105010091]
21. Goyal A, Prasad KN, Prasad A, Gupta S, Ghoshal U, Ayyagari A. Extended spectrum beta-lactamases in Escherichia coli & Klebsiella pneumoniae & associated risk factors. Indian J Med Res. 2009;129(6):695-700.
22. Serefhanoglu K, Turan H, Timurkaynak FE, Arslan H. Bloodstream infections caused by ESBL-producing E. coli and K. pneumoniae: risk factors for multidrug-resistance. Braz J Infect Dis. 2009;13(6):403-7. [DOI:10.1590/S1413-86702009000600003]
23. Gröbner S, Linke D, Schütz W, Fladerer C, Madlung J, Autenrieth IB, et al. Emergence of carbapenem-non-susceptible extended-spectrum β-lactamase-producing Klebsiella pneumoniae isolates at the university hospital of Tübingen, Germany. Journal of medical microbiology. 2009;58(7):912-22. [DOI:10.1099/jmm.0.005850-0]
24. Lartigue MF, Zinsius C, Wenger A, Bille J, Poirel L, Nordmann P. Extended-spectrum beta-lactamases of the CTX-M type now in Switzerland. Antimicrob Agents Chemother. 2007;51(8):2855-60. [DOI:10.1128/AAC.01614-06]
25. Al-Agamy MH, Shibl AM, Hafez MM, Al-Ahdal MN, Memish ZA, Khubnani H. Molecular characteristics of extended-spectrum beta-lactamase-producing Escherichia coli in Riyadh: emergence of CTX-M-15-producing E. coli ST131. Ann Clin Microbiol Antimicrob. 2014;13(1):4. [DOI:10.1186/1476-0711-13-4]
26. Wang X-r, Chen J-c, Yu K, Jiang N, An S-c, Gao Z-c. Prevalence and characterization of plasmid-mediatedblaESBL with their genetic environment inEscherichia coliandKlebsiella pneumoniaein patients with pneumonia. Chinese medical journal. 2012;125(5):894-900.
27. Alo M, Anyim C, Igwe J, Elom M. Presence of extended spectrum β-lactamase (ESBL) E. coli and K. pneumonia isolated from blood cultures of hospitalized patients. Advances in Applied Science Research. 2012;3(2):821-5.
28. Roy S, Mukherjee S, Singh AK, Basu S. CTX-M-9 group extended-spectrum beta-lactamases in neonatal stool isolates: emergence in India. Indian J Med Microbiol. 2011;29(3):305-8. [DOI:10.4103/0255-0857.83919]
29. Ishii Y, Alba J, Kimura S, Shiroto K, Yamaguchi K. Evaluation of antimicrobial activity of β-lactam antibiotics using Etest against clinical isolates from 60 medical centres in Japan. International journal of antimicrobial agents. 2005;25(4):296-301. [DOI:10.1016/j.ijantimicag.2004.12.003]
30. Bratu S, Tolaney P, Karumudi U, Quale J, Mooty M, Nichani S, et al. Carbapenemase-producing Klebsiella pneumoniae in Brooklyn, NY: molecular epidemiology and in vitro activity of polymyxin B and other agents. J Antimicrob Chemother. 2005;56(1):128-32. [DOI:10.1093/jac/dki175]
31. Mehd SDM, Asghar MS, Kazem SYM, Abdolaziz RL, Zahra R, Sovan AY. Antimicrobial Resistance Trends Of Klebsiella Spp. Isolated From Patients In Imam Khomeini Hospital. Payavard Salamat. 2012;6(4).
32. Amin A, Ghumro PB, Hussain S, A. H. Prevalence of antibiotic resistance among clinical isolates of Klebsiella pneumoniae isolated from a tertiary care hospital in Pakistan. Malays J Microbiol. 2009;5(2):81-6. [DOI:10.21161/mjm.13409]
33. Al Shara MA. Emerging antimicrobial resistance of klebsiella pneumonia strains isolated from pediatric patients in jordan. Iraqi J Med. 2011;7(2):29-32.
34. Tawfik AF, Alswailem AM, Shibl AM, Al-Agamy MH. Prevalence and genetic characteristics of TEM, SHV, and CTX-M in clinical Klebsiella pneumoniae isolates from Saudi Arabia. Microb Drug Resist. 2011;17(3):383-8. [DOI:10.1089/mdr.2011.0011]
35. Feizabadi MM, Delfani S, Raji N, Majnooni A, Aligholi M, Shahcheraghi F, et al. Distribution of bla TEM, bla SHV, bla CTX-M genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microbial drug resistance. 2010;16(1):49-53. [DOI:10.1089/mdr.2009.0096]
36. Ranjbar R, Memariani H, Sorouri R. Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Strains Isolated from Children with Urinary Tract Infections. Archives of Pediatric Infectious Diseases. 2016;5(2):e39000. [DOI:10.5812/pedinfect.39000]
37. Abrar S, Ain NU, Liaqat H, Hussain S, Rasheed F, Riaz S. Distribution of bla CTX - M , bla TEM , bla SHV and bla OXA genes in Extended-spectrum-beta-lactamase-producing Clinical isolates: A three-year multi-center study from Lahore, Pakistan. Antimicrob Resist Infect Control. 2019;8(1):80. [DOI:10.1186/s13756-019-0536-0]
38. Ahmed MAS, Bansal D, Acharya A, Elmi AA, Hamid JM, Ahmed AMS, et al. Antimicrobial susceptibility and molecular epidemiology of extended-spectrum beta-lactamase-producing Enterobacteriaceae from intensive care units at Hamad Medical Corporation, Qatar. Antimicrobial resistance and infection control. 2016;5(1):1-6. [DOI:10.1186/s13756-016-0103-x]
39. Effendi MH, Bintari I, Aksono E, Hermawan I. Detection of blaTem Gene of Klebsiella pneumoniae Isolated from swab of food-producing animals in East Java. Tropical Animal Science Journal. 2018;41(3):174-8. [DOI:10.5398/tasj.2018.41.3.174]
40. Ugbo E, Anyamene C, Moses I, Iroha I, Babalola O, Ukpai E, et al. Prevalence of blaTEM, blaSHV, and blaCTX-M genes among extended spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae of clinical origin. Gene Reports. 2020;21:100909. [DOI:10.1016/j.genrep.2020.100909]
41. Zhong XS, Li YZ, Ge J, Xiao G, Mo Y, Wen YQ, et al. Comparisons of microbiological characteristics and antibiotic resistance of Klebsiella pneumoniae isolates from urban rodents, shrews, and healthy people. BMC Microbiol. 2020;20(1):12. [DOI:10.1186/s12866-020-1702-5]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc