year 17, Issue 1 (January - February 2023)                   Iran J Med Microbiol 2023, 17(1): 66-72 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Khademi P, Ownagh A, Mardani K, Khalili M. PCR-RFLP of Coxiella burnetii Plasmids Isolated from Raw Milk Samples in Iran. Iran J Med Microbiol 2023; 17 (1) :66-72
URL: http://ijmm.ir/article-1-1722-en.html
1- Department of Microbiology, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran
2- Department of Microbiology, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran , ownagh@yahoo.com
3- Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran
4- Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran
Full-Text [PDF 613 kb]   (1039 Downloads)     |   Abstract (HTML)  (3555 Views)
Full-Text:   (872 Views)
Introduction


One of the obligate intracellular bacteria that induce severe Q fever and chronic endocarditis in humans is Coxiella burnetii. The fever is similar to flu and self-limiting; it can be treated easily using antibiotics, provided the diagnosis is carried out properly. The disease needs antibiotic therapy for a long time as the infection may lead to endocarditis or granulomatous hepatitis. It is imperative to differentiate C. burnetii rapidly in clinical specimens. The reason for this is the fact that proper antibiotic therapy can result in a better prognosis. The standard diagnosis of Q fever includes serological tests, given that isolating C. burnetii from patients is a long, complicated, and risky process. Still, serological tests are ineffective for treating afflicted patients as they only give a retrospective diagnosis (1, 2).
Several genotyping methods have been developed to distinguish C. burnetii isolates. One of these techniques is restriction enzyme fragment length polymorphism (RFLP) analysis of genomic DNA and PCR-RFLP of specific genes (1). Importance of RFLP Technology; Several studies have shown the high genetic diversity of C. burnetii strains by the RFLP method. In a study by Jaguar et al. The relationship between the geographical distributions of C. burnetii is shown by the RFLP method. An association between the RFLP group and the pathogenicity of the C. burnetii strain in a rodent acute Q fever model was demonstrated (2).
 Restriction fragment length polymorphisms (RFLP) in chromosomal have been explored in recent literature. Further research demonstrates the study of RFLP patterns using sodium dodecyl sulfate-polyacrylamide (3) or pulsed-field gel electrophoresis (4). Accordingly, making it possible to establish the creation of six distinct genomic groups (I through VI) is an important implication of the subsequent research. While the groups IV and V contained isolates from chronic disease patients, isolates from acute disease patients can be categorized into genomic groups. Moreover, presenting the categorized isolates in genomic groups I, II, and III and group IV is just to contain plasmid QpH1 and plasmid QpRS, respectively. Also, group V isolates are plasmid-less. However, QpRS-homologous sequences are marked in chromosomal genome sequences of the group V isolates (5, 6). Although recent investigations indicate that the group VI isolates might include QpH1 and QpDG, which are demonstrated to be virulent in guinea pigs, these isolates were suggested to be contained the plasmid QpDG. Further investigations have been carried out to specify a variety of isolates utilizing RFLP/ pulsed-field gel electrophoresis with various restriction enzymes (7), multispacer sequence typing (8), multiple loci variable number of tandem repeats analysis (9, 10), and microarrays (11). Those are set to discriminate the isolates into 36 distinct genotypes.
Identification of the C. burnetii plasmid can provide some basic information in the differential diagnosis and epidemiological investigation of Q fever. However, it was not possible to show a correlation between the six genomic groups of C. burnetii and their pathogenicity or clinical manifestations (12).
After completing the nine-mile phase I (9Mi / I) genomic sequence, 20 unique copies of transposed IS1111 were identified. Previous studies of insertion sequences have shown that the transposase coding region is surrounded by two sets of terminal reverse repeats, formerly known as medial and lateral reverse repeats (13). Inverse internal repeats are supposed to indicate the IS element term. IS1111 is expected to form a circular intermediate, bringing reverse internal repeats closer together to form a strong promoter, which in turn increases transposase expression. The outer reverse repeat is thought to be a chromosomal sequence that forms a stem-loop structure that serves as a recognition site for the insertion of the IS element but is not part of the IS element itself. There are more than 50 copies of 9Mi/I genome in such chromosomal target sequence (14).
Furthermore, the fragment of a transposon-like repetitive element to is utilized detect the bacterium in clinical samples, such as placental bits, genital and fecal swabs, urine, liver, spleen, placenta, heart valves, milk, blood, and serum samples [15, 16]. The analytical sensitivity of the Trans-PCR was found to be 109 (sometimes even 10 −1) C. burnetii particles per reaction mixture.
Due to the characterization of these plasmids, C. burnetii was classified into 6 genomic groups. The QpH1 plasmid was first obtained from tick isolates and was also detected in most isolates derived from domestic mites. Currently, the following new genotyping techniques are being developed. B. Multiple locus variable number tandem repeat analysis (VNTR) (MLVA), multi-spacer sequence typing (MST), and single nucleotide polymorphism (SNP) genotyping. The RFLP method is better than the sequence-based method because epidemiological studies should identify the stage of the disease (acute or chronic infection) and the genotype of the bacteria to determine how to treat the infection. It's cheap and easy (15). This report describes the PCR-RFLP assay results for directly identifying the C. burnetii plasmid QpH1 gene in dairy and buffalo.


 

Materials and Methods

Milk Sample

In the present research, 86 milk samples for the QpH1 gene that were positive by nested PCR in our previous study were selected. The four DNA samples of C. burnetii based on the IS1111 gene (16) were sequenced to confirm.

 DNA Extraction

DNA extraction of the selected Milk samples was carried out according to the kit's manufacturer instructions (Favorgen, Taiwan). The quality and amount of extracted DNA were evaluated by NanoDrop 2000c (Thermo Scientific, USA). Extracted DNA samples were kept at -20°C until use in PCR.

 Positive Control

The C. burnetii isolates used in this study comprised one QpH1 plasmid-containing strain (C. burnetii standard Nine Mile strain RSA 493).

Table 1. Primer sequences for detection of QpH1 gene by nested-PCR.

Protocol Primer Name Sequence
5'----3'
PCR product size (bp) PCR condition (Cycle) Reference
PCR CB5 ATAATGAGATTAGAACAACCAAGA 977 94 for 4m, 94 for2m, 53 for1m, 72 for2m, 72/5. (35) (17)
CB6 TCTTTCTTGTTCATTTTCTGAGTC
nested-PCR QpH1-F CTCGCTGACGGAAGAGGATCTTTT 602 94 for3m, 94 for45s, 50 for45s, 72 for45s, 72 for5m. (35) This study
QpH1-R TAACACTGCCCGTCGCTTTACT


Nested-PCR

In order to the molecular detection of the QpH1 plasmid, nested PCR was applied. The first stage pares primers for the detection of the QpH1 gene used based on what Zhang et al. previously described (17). For the nested- PCR, designed the second set of primers for QpH1-F and QpH1R using AmplifX (Version 2.2.0) software (table 1).

RFLP of QpH1 Plasmid

In order to consider the genetic map of QPH1 gene, restriction enzyme Hph1 (Thermo Fisher Scientific Inc. USA) (Takapouzist Co., Iran) was employed. The recommended protocol for the digestion of PCR products directly after amplification is based on enzyme HphI. Incubate at 37°C for 1-16 hours that explaind in (Table 2).

Table 2. HphI enzyme protocol.

name Volume (µL
PCR reaction mixture 10
Nuclease-free water 18
10X Buffer B 2
HphI 1-2


Detection of PCR Products

 The amplified products of PCR and the restricted products were examined by electrophoresis in a 2.5% agarose gel, stained with a safe stain (0.5 mg/mL), visualized under UV illumination (TM-20; UVP, Inc.) at 320 nm, and photographed.

 
 

Results

The specificity of the nested PCR with primers QpH1-F, QpH2-R was also confirmed by digesting the amplified products with Hph1, which yielded 168-bp and 279-bp fragments (Figure 1). All studied specimens contained two pieces of 168 bp and 279 bp. The PCR-RFLP results for QpH1 showed that the enzymatic cleavage of the positive PCR product caused no significant difference between patterns of enzymatic cleavage. In addition to confirming the PCR result, PCR-RFLP indicated that C. burnetii found in all specimens belonged to a single strain called C. burnetii Nine Mile.

Confirmation of C. burnetii Based on IS1111 Gene and Phylogenetic Analysis

The results confirmed the presence of C. burnetii. After modifying and aligning the sequences in MEGA-10, it was shown that all four sequences were completely similar and contained 160 bp. The Basic Local Alignment Search Tool (BLAST) results also revealed 100% similarity of these sequences with more than 50 sequences in the gene bank from different sources. Therefore, considering the 100% similarity with other isolates in different sources and regions, there was no need to plot a phylogenetic tree. Reference No. of these four sequences in the gene bank is as follows: MW172976, MW172975, MW172974, MW172973.
 

Figure 1. Specificity of the nested PCR with primers CB5- CB6 and QpH1-F-QpH1-R demonstrated the 602-bp amplification products were digested with Hph1, electrophoresed on agarose gel, and stained with safe stain. 
Figure 1. Specificity of the nested PCR with primers CB5- CB6 and QpH1-F-QpH1-R demonstrated the 602-bp amplification products were digested with Hph1, electrophoresed on agarose gel, and stained with safe stain.

 
 

Discussion

Although C. burnetii is considered homologous by serological methods and sequence analysis of the 16S rRNA gene, the data presented in this study highlights no genetic diversity among isolates. RFLP analysis by GE should be seen as a powerful tool for isolation typing (18).
Q fever is a zoonotic disease that is found in cattle and buffaloes in northwestern Iran (16, 19-24). Environmental pollution in infected farms is due to the excretion of bacteria by infected animals through the placenta, fetal fluids, vaginal secretions, feces, urine, and milk. In animals, the prevalence of Q fever in females is higher than in males due to the greater susceptibility of females to males. Pregnancy is also an important factor in the development of Q fever, and a higher incidence of the disease has been reported in cattle during pregnancy (15).
Q fever is not well known in Iran. Lack of knowledge about this disease leads to undiagnosed and under-reported cases of Q fever. C. burnetii is characterized by very high infectivity. C. burnetii can cause acute and chronic forms in humans and is isolated from a wide range of warm-blooded animals and arthropods. Previous studies have identified several forms of plasmids in this bacterium (25, 26).
So far, The C. burnetii isolate classification was introduced primarily to determine the pathogenicity of new isolates. Understanding the relationships between C. burnetii isolates was of little interest, probably because the differentiation method did not reveal sufficient diversity and a relatively small number of isolates were analyzed. The mentioned difference in RFLP between North American and European C. burnetii isolates shows a similar restriction pattern. Until today, Diversity between C. burnetii isolates has never been used to quantify associations (27, 28).
Rijks et al., working on the molecular epidemiology of C. burnetii in ruminants in the Netherlands, concluded that the genetic background of C. burnetii in ruminants was responsible for the prevalence of Q fever in humans (18). Astobiza et al. also carried out a study in 2012 on the genotype of C. burnetii isolated from domestic ruminants in northern Spain and found that there is a significant genetic diversity of C. burnetii (29).
The QpH1 plasmid, first isolated from mites, is widely found in isolates from cattle, sheep, and goats. Also, in a study by Porten et al. (30), nine isolates with plasmid were obtained from sheep and one from a human that was the causative agent of Q fever in North Rhine-Westphalia in 2003 (30). In Lofis et al. (31), a sample of chronic form plasmid (QpRS) was isolated from goat milk so that five of the six samples of cow's milk contained acute plasmid (QpH1) (31).
At the same time, in the study of Hilbert et al. (32) in Germany, all samples exhibited plasmid QpH1; such type of plasmid was the predominant one in isolates in Germany and the Netherlands (32). As a whole, the existence of a species of C. burnetii in buffalo and cattle milk of West Azerbaijan province was confirmed in the present research.
All C. burnetii positive samples gave identical profiles with the Nine Mile reference strain in the RFLP method. These results confirmed the previously reported by Spitalska (33) and Spyridaki, et al. (34). PCR-RFLP is a suggested method for the detection and identification of C. burnetii from clinical samples originating in humans and animals (33, 34). While the C. burnetii genome is still considered highly conserved, according to prior research, C. burnetii may be differentiated by RFLP of plasmids (35, 36). The first QpH1 plasmid was described by Loftis et al. (31). It was isolated from C. burnetii of the Nine Mile strain. The QpRS plasmid associated with the chronic form has also been described by Samuel et al. Chronic form plasmids have been isolated from goat placenta and humans with a chronic form of Q fever. PCR-RFLP is promising for diagnosing C. burnetii in the early culture stage, diagnosing acute and chronic forms of infections, and identifying bacteria from specific clinical specimens (heart valves) (37, 38). The profiles of the strains isolated from Q fever patients in France and Greece were reported to be identical with the reference C. burnetii Nine Mile strain from ticks originating from the USA (39).
In this study, profiles of all positive samples were also found to be similar to the reference Nine Mile RSA493 strain by RFLP. It also showed that it was impossible to easily conclude the type of plasmid and the course of C. burnetii infection. Therefore, the different outcomes of this disease cannot be determined by the type of plasmid. Perhaps other differences between the C. burnetii isolates encoded on the chromosomes are likely to play an important role. Recently, analysis of RFLP patterns has revealed significant differences in chromosome size from different C. burnetii restriction groups (40).
According to the results of the present study, PCR-RFLP of the amplified plasmid fragment in the positive samples showed no difference in enzymatic digestion patterns between samples. Therefore, there is no genetic heterogeneity among them, and all Coxiellas isolated from milk in the region of West Azerbaijan are the same.


 

Conclusion

The present study concludes no differences in RFLP patterns on C. burnetii plasmids. Therefore, there is no genetic heterogeneity among them, and all Coxiellas isolated from milk in the West Azerbaijan province are genetically identical. So, the infection in the different animals can be originated from one strain of C. burnetii (Nine Mile RSA493 strain).

 

Acknowledgment

The authors would like to thank the dean for the research and technology of Urmia University for funding the project. Mr. Kazemnia's technical assistance was also highly appreciated.

 

Conflicts of Interest

The authors declared there is no conflict of interest.

 

Author Contributions

P.K, A.O, K.M, and M.K conceptualized the study. P.K, A.O, K.M collected, analyzed, interpreted the data, and conducted the statistical analysis. P.K, A.O, and K.M wrote the first draft of the manuscript. All authors revised the manuscript and approved the final version. P.K and A.O had full access to all of the data in the study, and takes responsibility for the integrity of the data and the accuracy of the data analysis.

 

Funding

The authors would like to thank the dean for the research and technology of Urmia University for funding the Ph.D. project (Thesis No: D 99-213).


 

Type of Study: Original Research Article | Subject: Zoonoses Research
Received: 2022/04/13 | Accepted: 2022/09/11 | ePublished: 2023/01/20

References
1. Chochlakis D, Santos AS, Giadinis ND, Papadopoulos D, Boubaris L, Kalaitzakis E, et al. Genotyping of Coxiella burnetii in sheep and goat abortion samples. BMC Microbiol. 2018;18(1):1-9. [DOI:10.1186/s12866-018-1353-y] [PMID] [PMCID]
2. Sobotta K, Hillarius K, Jiménez PH, Kerner K, Heydel C, Menge C. Interaction of Coxiella burnetii Strains of Different Sources and Genotypes with Bovine and Human Monocyte-Derived Macrophages. Front Cell Infect Microbiol. 2018;7:543-. [DOI:10.3389/fcimb.2017.00543] [PMID] [PMCID]
3. Hendrix LR, Samuel JE, Mallavia LP. Differentiation of Coxiella burnetii isolates by analysis of restriction-endonuclease-digested DNA separated by SDS-PAGE. Microbiology. 1991;137(2):269-76. [DOI:10.1099/00221287-137-2-269] [PMID]
4. Heinzen R, Stiegler G, Whiting L, Schmitt S, Mallavia L, Frazier M. Use of Pulsed Field Gel Electrophoresis to Differentiate Coxiella burnetii Strains a. Ann N Y Acad Sci. 1990;590(1):504-13. [DOI:10.1111/j.1749-6632.1990.tb42260.x] [PMID]
5. Willems H, Ritter M, Jäger C, Thiele D. Plasmid-homologous sequences in the chromosome of plasmidless Coxiella burnetii Scurry Q217. J Bacteriol. 1997;179(10):3293-7. [DOI:10.1128/jb.179.10.3293-3297.1997] [PMID] [PMCID]
6. Savinelli EA, Mallavia LP. Comparison of Coxiella burnetii plasmids to homologous chromosomal sequences present in a plasmidless endocarditis-causing isolate. Ann N Y Acad Sci. 1990;590:523-33. [DOI:10.1111/j.1749-6632.1990.tb42262.x] [PMID]
7. Jäger C, Lautenschläger S, Willems H, Baljer G. Coxiella burnetii plasmid types QpDG and QpH1 are closely related and likely identical. Vet Microbiol. 2002;89(2-3):161-6. [DOI:10.1016/S0378-1135(02)00155-4] [PMID]
8. Glazunova O, Roux V, Freylikman O, Sekeyova Z, Fournous G, Tyczka J, et al. Coxiella burnetii genotyping. Emerg Infect Dis. 2005;11(8):1211. [DOI:10.3201/eid1108.041354] [PMID] [PMCID]
9. Arricau-Bouvery N, Hauck Y, Bejaoui A, Frangoulidis D, Bodier CC, Souriau A, et al. Molecular characterization of Coxiella burnetii isolates by infrequent restriction site-PCR and MLVA typing. Bmc Microbiol. 2006;6(1):1-14. [DOI:10.1186/1471-2180-6-38] [PMID] [PMCID]
10. Svraka S, Toman R, Skultety L, Slaba K, Homan WL. Establishment of a genotyping scheme for Coxiella burnetii. FEMS Microbiol Lett. 2006;254(2):268-74. [DOI:10.1111/j.1574-6968.2005.00036.x] [PMID]
11. Beare PA, Samuel JE, Howe D, Virtaneva K, Porcella SF, Heinzen RA. Genetic diversity of the Q fever agent, Coxiella burnetii, assessed by microarray-based whole-genome comparisons. J Bacteriol. 2006;188(7):2309-24. [DOI:10.1128/JB.188.7.2309-2324.2006] [PMID] [PMCID]
12. Dragan AL, Voth DE. Coxiella burnetii: international pathogen of mystery. Microbes Infect. 2020;22(3):100-10. [DOI:10.1016/j.micinf.2019.09.001] [PMID] [PMCID]
13. Hoover T, Vodkin M, Williams J. A Coxiella burnetti repeated DNA element resembling a bacterial insertion sequence. J Bacteriol. 1992;174(17):5540-8. [DOI:10.1128/jb.174.17.5540-5548.1992] [PMID] [PMCID]
14. Partridge SR, Hall RM. The IS 1111 family members IS 4321 and IS 5075 have subterminal inverted repeats and target the terminal inverted repeats of Tn 21 family transposons. J Bacteriol. 2003;185(21):6371-84. [DOI:10.1128/JB.185.21.6371-6384.2003] [PMID] [PMCID]
15. Eldin C, Mélenotte C, Mediannikov O, Ghigo E, Million M, Edouard S, et al. From Q fever to Coxiella burnetii infection: a paradigm change. Clin Microbiol Rev. 2017;30(1):115-90. [DOI:10.1128/CMR.00045-16] [PMID] [PMCID]
16. Khalili M, Sakhaee E, Aflatoonian MR, Shahabi-Nejad N. Herd-prevalence of Coxiella burnetii (Q fever) antibodies in dairy cattle farms based on bulk tank milk analysis. Asian Pac J Trop Med. 2011;4(1):58-60. [DOI:10.1016/S1995-7645(11)60033-3] [PMID]
17. Zhang G, Hotta A, Mizutani M, Ho T, Yamaguchi T, Fukushi H, et al. Direct identification of Coxiella burnetii plasmids in human sera by nested PCR. J Clin Microbiol. 1998;36(8):2210-3. [DOI:10.1128/JCM.36.8.2210-2213.1998] [PMID] [PMCID]
18. Rijks JM, Roest HIJ, van Tulden PW, Kik MJL, Ijzer J, Gröne A. Coxiella burnetii infection in roe deer during Q fever epidemic, the Netherlands. Emerg Infect Dis. 2011;17(12):2369-71. [DOI:10.3201/eid1712.110580] [PMID] [PMCID]
19. Khademi P, Mahzounieh MR, Kahrizsangi AE, Shdravan E. Genomic detection of Coxiella burnetii in goat milk samples in animal farms Khorramabad Township, Iran. Pajoohandeh J. 2014;19(3):162-8.
20. Khademi P, Ownagh A, Ataei B, Kazemnia A, Enferadi A, Khalili M, et al. Prevalence of C. burnetii DNA in sheep and goats milk in the northwest of Iran. Int J Food Microbiol. 2020;331:108716. [DOI:10.1016/j.ijfoodmicro.2020.108716] [PMID]
21. Khademi P, Ownagh A, Mardani K, Khalili M. Prevalence of Coxiella burnetii in milk collected from buffalo (water buffalo) and cattle dairy farms in Northwest of Iran. Comp Immunol Microbiol Infect Dis. 2019;67:101368. [DOI:10.1016/j.cimid.2019.101368] [PMID]
22. Khalili M, Mosavi M, Diali HG, Mirza HN. Serologic survey for Coxiella burnetii phase II antibodies among slaughterhouse workers in Kerman, southeast of Iran. Asian Pac J Trop Biomed. 2014;4:S209-S12. [DOI:10.12980/APJTB.4.2014C1268] [PMID] [PMCID]
23. Khalili M, Shahabi-Nejad N, Golchin M. Q fever serology in febrile patients in southeast Iran. Trans R Soc Trop Med Hyg. 2010;104(9):623-4. [DOI:10.1016/j.trstmh.2010.04.002] [PMID]
24. Khanzadi S, Jamshidi A, Razmyar J, Borji S. Identification of Coxiella burnetii by touch-down PCR assay in unpasteurized milk and dairy products in North-East of Iran. Iran J Vet Med. 2014;8(1):15-9.
25. Khademi P, Ownagh A, Ataei B, Kazemnia A, Eydi J, Khalili M, et al. Molecular detection of Coxiella burnetii in horse sera in Iran. Comp Immunol Microbiol Infect Dis. 2020;72:101521. [DOI:10.1016/j.cimid.2020.101521] [PMID] [PMCID]
26. Yaghmaie F, Esmaeili S, Francis SA, Mostafavi E. Q fever endocarditis in Iran: A case report. J Infect Public Health. 2015;8(5):498-501. [DOI:10.1016/j.jiph.2014.12.004] [PMID]
27. Hemsley CM, O'Neill PA, Essex-Lopresti A, Norville IH, Atkins TP, Titball RW. Extensive genome analysis of Coxiella burnetii reveals limited evolution within genomic groups. BMC Geno. 2019;20(1):1-17. [DOI:10.1186/s12864-019-5833-8] [PMID] [PMCID]
28. Körner S, Makert GR, Ulbert S, Pfeffer M, Mertens-Scholz K. The prevalence of Coxiella Burnetii in hard ticks in Europe and their role in Q fever transmission revisited-A systematic review. Front Vet Sci. 2021;8:655715. [DOI:10.3389/fvets.2021.655715] [PMID] [PMCID]
29. Astobiza I, Tilburg JJ, Piñero A, Hurtado A, García-Pérez AL, Nabuurs-Franssen MH, et al. Genotyping of Coxiella burnetii from domestic ruminants in northern Spain. BMC Vet Res. 2012;8:241. [DOI:10.1186/1746-6148-8-241] [PMID] [PMCID]
30. Porten K, Rissland J, Tigges A, Broll S, Hopp W, Lunemann M, et al. A super-spreading ewe infects hundreds with Q fever at a farmers' market in Germany. BMC Infect Dis. 2006;6(1):147. [DOI:10.1186/1471-2334-6-147] [PMID] [PMCID]
31. Loftis AD, Priestley RA, Massung RF. Detection of Coxiella burnetii in commercially available raw milk from the United States. Foodborne Pathog Dis. 2010;7(12):1453-6. [DOI:10.1089/fpd.2010.0579] [PMID]
32. Hilbert A. Coxiella burnetii-Epidemiologische Untersuchungen zum Vorkommen und zur Verbreitung in Schaf-und Rinderbeständen in Deutschland 2016.
33. Špitalská E, Kocianová E. Detection of Coxiella burnetii in ticks collected in Slovakia and Hungary. Eur J Epidemiol. 2003;18(3):263-6. [DOI:10.1023/A:1023330222657] [PMID]
34. Spyridaki I, Psaroulaki A, Loukaides F, Antoniou M, Hadjichristodolou C, Tselentis Y. Isolation of Coxiella burnetii by a centrifugation shell-vial assay from ticks collected in Cyprus: detection by nested polymerase chain reaction (PCR) and by PCR-restriction fragment length polymorphism analyses. Am J Trop Med Hyg. 2002;66(1):86-90. [DOI:10.4269/ajtmh.2002.66.86] [PMID]
35. Keshavamurthy R, Singh B, Kalambhe D, Aulakh R, Dhand N. Identification of risk factors associated with Coxiella burnetii infection in cattle and buffaloes in India. Prev Vet Med. 2020:105081. [DOI:10.1016/j.prevetmed.2020.105081] [PMID]
36. Porter SR, Czaplicki G, Mainil J, Guattéo R, Saegerman C. Q Fever: current state of knowledge and perspectives of research of a neglected zoonosis. Int J Microbiol. 2011;2011. [DOI:10.1155/2011/248418] [PMID] [PMCID]
37. Spyridaki I, Psaroulaki A, Aransay A, Scoulica E, Tselentis Y. Diagnosis of quinolone-resistant Coxiella burnetii strains by PCR-RFLP. J Clin Lab Anal. 2000;14(2):59-63. https://doi.org/10.1002/(SICI)1098-2825(2000)14:2<59::AID-JCLA4>3.0.CO;2-P [DOI:10.1002/(SICI)1098-2825(2000)14:23.0.CO;2-P]
38. Jang Y-R, Song JS, Jin CE, Ryu B-H, Park SY, Lee S-O, et al. Molecular detection of Coxiella burnetii in heart valve tissue from patients with culture-negative infective endocarditis. Medicine. 2018;97(34). [DOI:10.1097/MD.0000000000011881] [PMID] [PMCID]
39. Capin GA, Emre Z, Canpolat S, Vatansever Y, Duzgun A. Detection of Coxiella burnetii from ticks by polymerase chain reaction and restriction fragment length polymorphism. 2013. [DOI:10.1501/Vetfak_0000002590]
40. Barberio A. Coxiella burnetii infection in dairy cows and goats: Assessment of diagnostic methods, and evaluation of immune response in shedders. 2016.

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc