سال 13، شماره 1 - ( فروردین - اردیهبشت 1398 )                   جلد 13 شماره 1 صفحات 79-69 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kalteh S, Ojagh S M, Tabarrayi A, Zolfaghari M. Investigating the Possibility of the Listeria Monocytogenes Entering Into a Viable But Non-Culturable (VBNC) Form and Expression of the Pathogenic Genes During the Frozen Storage of (-18ºC) Rainbow Trout Fish Nugget. Iran J Med Microbiol. 2019; 13 (1) :69-79
URL: http://ijmm.ir/article-1-910-fa.html
کلته صونا، اجاق سید مهدی، تبرائی علیجان، ذوالفقاری مهدی. بررسی امکان ورود باکتری Listeria monocytogenes به حالت زنده اما غیرقابل کشت و بیان ژن های بیماری زایی آن طی دوره انجماد (ºC18-) ناگت ماهی قزل آلای رنگین‌کمان (Oncorhynchus Mykiss). مجله میکروب شناسی پزشکی ایران. 1398; 13 (1) :79-69

URL: http://ijmm.ir/article-1-910-fa.html


1- گروه شیلات، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران
2- گروه شیلات، دانشکده شیلات و محیط زیست، دانشگاه علوم کشاورزی و منابع طبیعی گرگان، گرگان، ایران ، Mahdi_ojagh@yahoo.com
3- گروه میکروب شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی گلستان، گرگان، ایران
واژه‌های کلیدی: Listeria monocytogenes، VBNC، hly، inlA، انجماد
متن کامل [PDF 927 kb]   (1391 دریافت)     |   چکیده (HTML)  (4324 مشاهده)
متن کامل:   (2332 مشاهده)
مقدمه

Listeria monocytogenes گروهی از باکتری‌های گرم مثبت، میله‌ای‌شکل، بدون اسپور، کاتالاز مثبت و اکسیداز منفی هستند (1). فرم بدون اسپور این باکتری به فریزکردن و خشک‌کردن مقاوم است. لیستریا می‌تواند درجه حرارت کم (ºC0/4-) و بازۀ گسترده­ای از pH (3/6 تا 9/6) و همچنین فعالیت آبی (aw) نسبتاً کم و غلظت زیاد نمک (10 درصد<) را تحمل ­کند (2). نگرانی رو به رشد در دهه­ های گذشته ورود L. monocytogenes به غذاها بوده است (3). این پاتوژن منجر به بیماری لیستریوزیس می­شود؛ یک بیماری نادر اما جدی، به‌ویژه برای گروه در خطر (3) که غالباً شامل بزرگسالان دچار نقص ایمنی، افراد مسن، نوزادان تازه متولدشده و زنان باردار هستند و همراه با سقط جنین، مرده­زایی، سپتی‌سمی و مننژیت است (4). در سال 2007 در اتحادیه اروپا 0/3 مورد در هر 100هزار مورد با نرخ مرگ‌ومیر 20 درصد ناشی از لیستریوزیس گزارش شده است (3).
موارد متعددی از شیوع لیستریوزیس در اثر مصرف غذاهای دریایی گزارش شده است (5). برخی از کشورها حد مجاز صفر را برای L. monocytogenes در ماهی ­های وارداتی در نظر گرفته ­اند. بنابراین تقاضای تولیدکنندگان محصولات دریایی برای مواد خام عاری از L. monocytogenes در طول فرآوری‌ محصولات دریایی اهمیت قابل توجهی دارد (6). L. monocytogenes از محصولات دریایی مثل ماهی دودی، محصولات دریایی پخته و منجمد، ترشی ماهی و سوریمی جداسازی شده است (7). با اینکه 13 سروتیپ از سویه L. monocytogenes شناسایی شده­ اند، اغلب موارد انسانی شامل سروتی پ­های 1.2a، 1.2b و 4b است (8-10) سروتیپ­ 4b مسئول شیوع بسیاری از موارد لیستریوزیس با منشأ غذایی است (9). این پاتوژن تحت شرایط استرس­ زای مختلف از جمله انکوباسیون خارج از دمای بهینه رشد، شوری زیاد، افزایش فشار اسمزی، غلظت اکسیژن، نور مرئی، گرسنگی و فرایندهایی که تصور می­ شود منجر به نابودی باکتری می­ شود، وارد حالت «زنده اما غیرقابل کشت»[1] می­ شود (11-15). این تعریف برای حالتی است که باکتری­ به دلیل حفظ فعالیت متابولیکی زنده است، اما قابلیت کشت و رشد را ندارد. بنابراین کلنی­ها را در محیط‌های اختصاصی کشت معمول توسعه نمی­ دهد (6). به نظر می­رسد عوامل بیماری­زایی شامل actA، hly، iap، inlA وplcA نقش ویژه‌ای در بیماری­زایی L. monocytogenes دارند (16-20). hly کدکننده لیستریولیزین O است که برای لیز حفره‌ مانند و ورود به سیتوزول سلول ضروری است (17). ژن inlA عملکرد مهمی در تهاجم باکتری با مکانیسم انتروسیتوز[2] دارد (19).
از آنجایی که لیستریولایزین O (hly) عامل بیماری­زای مهمی در L. monocytogenes است، بیان ژن hly در فاز VBNC نشان‌دهنده توانایی بیماری­زایی باکتری در این فاز VBNC است (11-22). در این راستا توانایی ورود L. monocytogenes جداشده از سالمون خام، محیط فرآوری‌ این ماهی و بیماران مبتلا به لیستریوزیس، به فاز VBNCو نیز بیماری­زایی آن ارزیابی و بررسی شده است. این ارزیابی‌ها نشان داده است همه سویه­ ها پس از گرسنگی وارد فازVBNC می­شوند و در حضور سدیم پیروات و تغذیه با مواد غذایی جایگزین احیاء نمی­ شوند (23). همچنین این مطالعات نشان داده است همزمان با از دست‌رفتن قابلیت کشت، خاصیت بیماری­زایی نیز از دست می­ رود. همچنین عنوان شده است سویه­ های L. monocytogenes ممکن است در محیط آبی برای دوره­ های طولانی­ تری در فاز VBNC بمانند، اما این سلول‌ها بیماری­زا نیستند (24). انجماد محصول فرآوری‌‌شده روشی مناسب برای جلوگیری از رشد L. monocytogenes است. هر چند L. monocytogenes (در صورت وجود) در محصول نهایی یا فرآوری‌‌شده با انجماد از بین نمی­ رود، اما رشد آن طی دوره انجماد متوقف خواهد شد. انجماد و ذخیره طولانی مدت به شکل منجمد می­تواند تأثیراتی منفی روی خواص محصول بگذارد. همچنین، با وجود نگهداری محصول فرآوری‌‌شده در فریزر به صورت طولانی مدت، انجمادزدایی می­تواند منجر به رشد L. monocytogenes در محصول فرآوری‌‌شده شود (25). پس از انجماد گونه­های مختلف، انواع متفاوتی از بقا را در ارتباط با اندازه سلول و شکل و ساختار آن نشان داده­اند. باکتری­هایی با اندازه بزرگ‌تر و پیچیدگی بیشتر در مقابل آسیب­های انجماد نسبت به انواع کوچک‌تر و ساده­تر مقاومت کمتری دارند (26، 27). توانایی ورود L. monocytogenes به فاز VBNC طی استرس­های حین فرآوری‌ نگران‌کننده است؛ به دلیل آنکه آزمون­های باکتریولوژیکی کشت معمول، موفق به شناسایی ارگانیسم­های غیرقابل کشت در محصول و محیط فرآوری‌ نشده و ریسک خطر مصرف لیستریا مونوسیتوژنز در فاز VBNC هنوز ناشناخته است. یکی از این استرس­ها انجماد است. به همین دلیل هدف از این مطالعه بررسی امکان ورود L. monocytogenes به حالت VBNC طی انجماد ºC18- با استفاده از بررسی بیان ژن 16S rRNA و بررسی بیماری­زایی آن با استفاده از ژن­های hly و inlA است.

 
مواد و روش‌ها

باکتری L. monocytogenes سویه استاندارد ATCC 19115 (سروتیپ 4bاز سازمان پژوهش‌های علمی و صنعتی ایران در سال 1397 به صورت لیوفیلیزه تهیه شد. باکتری‌ها در محیط BHI براث به مدت 24 ساعت در ºC37 انکوبه شدند. سپس روی محیط BHI آگار کشت شدند و 24 ساعت در ºC37 انکوبه و یک کلونی خالص از آن برای ادامه مطالعات استفاده شد.

محیط‌های بررسی‌شده
امکان ورود باکتری L. monocytogenes به حالت VBNC در دمای انجماد ºC18- در سه محیط سرم فیزیولوژی (NS)Normal saline (به عنوان شرایط نبود مواد تغذیه‌ای و ماتریکس محافظت‌کننده) BHI براث (شرایط محیط تغذیه‌ای غنی) و آبگوشت ماهی یا Fish Broth (FB) (شرایط ماتریکس گوشت ماهی) قزل‌آلای رنگین‌کمان (Oncorhynchus mykiss) بررسی شد. محیط BHI براث طبق برنامه شرکت مربوطه آماده‌سازی و اتوکلاو شد.
 
آماده‌سازی محیط آبگوشت ماهی قزل‌آلای رنگین‌کمان (FB)
 عصاره ماهی قزل‌آلای رنگین‌کمان به روش Nilsson و همکاران (1999) آماده شد. در این روش ابتدا ماهی قزل‌آلا تمیز (پوست‌کنی و تخلیه امعا و احشا) و چرخ شد. در ادامه با آب مقطر به نسبت 1:2 (وزنی/حجمی) به مدت 10 دقیقه جوشانده و به مدت 10 دقیقه فیلتر شد. عصاره حاصل با افزودن 5/98 گرم در لیتر KH2PO4 و 9/75 گرم در لیتر K2HPO4 بافری و pH آن با استفاده از HCl 1 مولار در 6/2 ثابت شد. عصاره تهیه‌شده به مدت 15 دقیقه در دمای ºC121 استریل و تا 24 ساعت پیش از تلقیح در دمای ºC4 نگهداری شد (28).

آماده‌سازی باکتری‌ها به منظور تلقیح به محیط‌های کشت
یک کلونی خالص به 10 میلی‌لیتر محیط BHI براث استریل منتقل شد و در انکوباتور شیکردار با دور rpm 200 انکوبه شد (29). باکتری‌ها در جذب حدود 0/4 (OD600) معادل تقریباً 109 باکتری در هر میلی لیتر بودند. در این میزان جذب باکتری‌ها تقریباً در اوایل تا اواسط مرحله رشد لگاریتمی است.

تلقیح باکتری‌ها به محیط‌های کشت
بدین منظور از باکتری‌ها در جذب 0/4 با تعداد 109 باکتری در هر میلی لیتر استفاده شد. برای تهیه پلیت باکتری، محلول باکتریایی با دور rpm 7000 به مدت 5 دقیقه سانتریفیوژ شد. قبل از تلقیح به محیط ­های کشت مدنظر، با سه مرحله رقیق‌سازی 10/1، تعداد باکتری­ها به 106 در هر میلی‌لیتر رسید. برای این منظور 200 میکرولیتر از سوسپانسیون حاوی باکتری به 1800 میکرولیتر محیط‌های NS، BHI براث و FB تلقیح شد. پس از تلقیح، از تیمار 3 نمونه به طور تصادفی برای تعیین تعداد اولیه باکتری روی محیط BHI آگار کشت داده شد.

شوک انجماد نمونه ­ها
هر تیمار با سه تکرار به ترتیب 4 و 8 ساعت و 2، 4، 8، 20، 30 و 60 روز پس از قرارگیری نمونه­ها در فریزر ºC18- تا رسیدن زمان موعد کلنی کانت و استخراج، قرار داده شدند.

شمارش کلنی
در انتهای زمان فریزکردن نمونه‌ها، به منظور بررسی تعداد باکتری‌های کشت‌پذیر روی محیط BHI آگار غنی‌شده با 2 درصد عصاره مخمر و 5/0 درصد سدیم پیروات، شمارش کلنی انجام شد. در تمامی زمان­های فوق شمارش کلنی هر سه محیط پس از 24 و 48 ساعت بررسی و شمارش شد.

بررسی بیان ژن
بدین منظور ژن 16S rRNA به عنوان ژن خانه‌گردان (Houskeeping gene) همچنین ژن­های hly و inlA به عنوان ژن­های بیماری­زایی این باکتری (30) برای مقایسه در دو محیط BHI و FB بررسی شدند. بررسی بیان این ژن­ها یک‌بار قبل از شوک و بار دیگر بعد از شوک انجماد طی روزهای 2 و 20 به منظور مقایسه بیان آنها انجام شد. برای بررسی بیان ژن به ترتیب زیر مراحل انجام شد:

استخراج RNA باکتری
بدین منظور از کیت استخراج شرکت سیناکلون، ایران استفاده شد که مراحل آن طبق برنامه به شرح زیر است:
1. تهیه رسوب باکتری ( min2-rpm 10000)؛ 2. افزودن lµ 40 آنزیم لیزوزیم mg 0/4 (min 20/ ºC37)؛ 3. افزودن µl 400 محلول لیز لایزیز بافر انکوبه‌شده؛ 4. افزودن µl 300 از محلول precipitation؛ 5. انتقال به ستون استخراج RNA (min 1-rpm 13000)؛ 6. افزودن lµ 400 محلول شست‌وشوی اول (min 1-rpm 13000)؛ 7. افزودن lµ 400 محلول شست‌وشوی دوم به تعداد 2 بار (min 1-rpm 13000)؛ 8. رفع اتانول احتمالی باقی‌مانده (min 2-rpm 13000)؛ 9. انتقال ستون­ ها به میکروتیوب جدید ml 5/1؛ 10. افزودن lµ 30 از محلول RNase free water انکوبه‌شده در دمای ºC55 به ستون­ها (min 1-rpm 13000) دو بار. RNA حاصل تا زمان استفاده در ºC70- نگهداری شد.
برای حذف DNA ناشی از آلودگی با استفاده از کیت DNase شرکت Genet Bio به شرح زیر استفاده شد:
به ازای هر gµ 1 RNA مقدار lµ 1 بافر MgCl2 و lµ 1 آنزیم DNase افزوده و مخلوط درºC37 به مدت 30 دقیقه انکوبه شد. در انتها مقدار lµ 1 EDTA به میکروتیوب افزوده و به مدت 10 دقیقه درºC65 به منظور توقف فعالیت آنزیم DNase انکوبه شد. RNA حاصل به منظور استفاده در RT PCR و سنتز cDNA استفاده شد.

سنتز cDNA
به منظور سنتز cDNA از کیت ABI استفاده شد. بدین منظور مستر ساخت cDNA با حجم lµ 10 که شامل موارد زیر است ساخته شد: RT Buffer(2 µl)، dntp(0.8 µl) ، Random Primer(2 µl)، RT(1)، DW(4.2 µl). درنهایت با µl 10 از RNA ترکیب شدند. برنامه دمایی ساخت cDNA به شرح زیر بود: 1. ºC25، 10 دقیقه؛ 2. ºC37، 120 دقیقه؛ 3. ºC85، 5 دقیقه. cDNA سنتزشده به منظور انجام فرایند PCR استفاده شد.

فرایند PCR
به منظور انجام عملیات PCR از کیت Prim Taq Premix (2X) شرکت Genet Bio با دستور تهیه مستر میکس به صورت زیر استفاده شد: Buffer (2.5 µl)، Mgcl2 (2 µl)، dntp (0.5 µl)، Taq (0.2 µl)، Primer Forward (0.5 µl (10 pm))، Primer Riverse (0.5 µl (10 pm))، DW (12.8 µl). میزان نمونه cDNA µl1 بود. مخلوط به مدت 10 ثانیه سانتریفیوژ جزئی شد تا قطراتی که روی جداره میکروتیوپ بود، حذف شود. سپس در دستگاه PCR با تنظیمات دمایی زیر قرار داده شد:
1. واسرشت اولیه 5 دقیقه در ºC95؛ 2. تکثیر DNA به تعداد 37 چرخه: الف) واسرشت 30 ثانیه در ºC94، ب) اتصال پرایمر: 40 ثانیه در ºC60، ج) گسترش: 40 ثانیه در ºC72؛ 3. باز سرشت نهایی 5 دقیقه در ºC72.
الکتروفورز محصول PCR با استفاده از ژل 2-1/5 درصد آگارز صورت پذیرفت و سپس از ژل با استفاده از دستگاه ژل داک عکس‌برداری شد. توالی پرایمرهای استفاده شده در جدول یک درج شده است.
 
کشت در محیط بلاد آگار
به منظور احیای احتمالی باکتری­ ها، در انتهای دوره انجماد از محیط آبگوشت ماهی بر روی محیط بلاد آگار کشت داده شد و به مدت 48-24 ساعت در دمای ºC37 انکوبه و همولیز بتای آن بررسی شد. سپس بیان هر سه ژن 16s rRNA، hly و inlA بررسی شد.

تجزیه و تحلیل آماری
این آزمایش در قالب طرح کاملاً تصادفی انجام گرفت. نتایج داده­های پارامتریک با روش ­های ANOVA ارزیابی شد و مقایسه میانگین­ها با آزمون LSD صورت پذیرفت. برای تجزیه و تحلیل آماری داده­ های نرمال از آزمون دانکن و برای داده­های غیرنرمال از آزمون من ویتنی استفاده شد. در مواقع لزوم از آزمون ناپارامتریک کای اسکوور برای تجزیه و تحلیل داده ­های ناپارامتریک استفاده شد. تمام تجزیه و تحلیل‌ها در سطح اطمینان 5 درصد و با نرم افزار SPSS صورت پذیرفت. نتایج به‌دست‌آمده با ترسیم نمودارها با استفاده از نرم‌افزار اکسل انجام شد.
 
              
جدول 1. توالی پرایمرهای استفاده‌شده در پژوهش (31-33)
اندازه محصول
(bp )
دمای اتصال
(ºC)
توالی الیگونوکلئوتید نام ژن
109 60 F: TTA GCT AGT TGG TAG GGT
R: AAT CCG GAC AAC GCT TGC
16S rRNA
139 60 F: CGCAACAAACTGAAGCAAAGG
R: TTGGCGGCACATTTGTCAC
hly
95 60 F: CGGATGCAGGAGAAAATCC
R: CTTTCACACTATCCTCTCC
inlA

یافته‌ها

بررسی نتایج شمارش کلنی باکتری­ ها در محیط BHI آگار غنی‌شده
نتایج بررسی شمارش کلنی در محیط BHI آگار غنی‌شده در هر سه تیمار NS، BHI براث، FB طی زمان­های 4 و 8 ساعت و 2، 4، 8، 20، 30 و 60 روز پس از قرارگیری نمونه ­ها در فریزر، نشان داد این باکتری در شوک دمایی ºC18- قابلیت رشد روی محیط‌ کشت غنی‌شده BHI آگار را حفظ کرده است، اما تعداد آنها طی این زمان با کاهش همراه بود (شکل 1).
شکل 1. نتایج روند کلنی کانت باکتری L.monocytogenes در دمای ºC18- در در تیمارهای BHI (BHI Broth) و FB (Fish Broth)
محور افقی: مدت زمان سپری‌شده (دو زمان اول 4 ساعت و 8 ساعت پس از شوک مربوط به روز اول و زمان­های بعدی در روزهای بعدی)؛ محور عمودی: لگاریتم تعداد باکتری

نتایج بررسی بیان ژن

بررسی نتایج شمارش کلنی باکتری­ها در محیط BHI آگار غنی شده
نتایج بررسی بیان ژن­های 16s rRNA، hly و inlA قبل از شوک انجماد نشان‌دهنده بیان هر سه ژن و داشتن خاصیت بیماری­زایی این باکتری بود (شکل 2).
نتایج الکتروفورز محصول PCR باکتری‌ها پس از شوک انجماد برای روز دوم استخراج نشان‌دهنده بیان ژن 16S rRNA در هر دو تیمارBHI براث و FB بود. طبق این نتایج باکتری L. monocytogenes در دمای ºC18- به مدت 20 دقیقه قادر به زنده ماندن است و ژن خانه‌گردان خود را نیز بیان می‌کند. همچنین شاهد بیان ژن hly به ترتیب در تکرارهای دوم و اول محیط­های BHI و FB بودیم. ژن inlA در هیچ‌کدام از تیمارها بیان نشد (شکل 3).

 

شکل 2. نتایج الکتروفورز محصول PCR حاصل فرایند بررسی بیان ژن 16s rRNA، hly و inlA قبل از شوک انجماد
ترتیب و تکرار تیمارها برای هر دو محیط به ترتیب 1، 2 و 3؛ کنترل مثبت (C+) شامل DNA لیستریا مونوسیتوژنز؛ کنترل منفی (C-) شامل نمونه بدون الگو


 

شکل 3. نتایج الکتروفورز محصول PCR حاصل فرایند بررسی بیان ژن 16s rRNA، hly و inlA در تیمارهای BHI (BHI Broth) و FB (Fish Broth) در روز دوم انجماد ترتیب و تکرار تیمارها برای هر دو محیط به ترتیب 1، 2 و 3؛ کنترل مثبت (C+) شامل DNA لیستریا مونوسیتوژنز؛ کنترل منفی (C-) شامل نمونه بدون الگو
     
شکل 4. نتایج الکتروفورز محصول PCR حاصل فرایند بررسی بیان ژن 16s rRNA، hly و inlA در تیمارهای BHI (BHI Broth) و FB (Fish Broth) در روز بیستم انجماد ترتیب و تکرار تیمارها برای هر سه محیط به ترتیب 1، 2 و 3؛ کنترل مثبت (C+) شامل DNA لیستریا مونوسیتوژنز؛ کنترل منفی (C-) شامل نمونه بدون نمونه

نتایج الکتروفورز برای روز بیستم استخراج نشان‌دهنده بیان ژن 16S rRNA در هر دو تیمار BHI براث و FB بود. ژن hly و ilnA در هیچ‌کدام از تیمارها بیان نشد (شکل 4).
از مقایسه نتایج بررسی بیان ژن با نتایج شمارش کلنی در محیط‌ کشت غنی‌شده BHI آگار، می­توان به این نتیجه رسید باکتری موجود در هر سه محیط طی شوک انجماد زنده است و خاصیت بیماری­زایی خود را از طریق بیان ژن hly در دو محیط شرایط مغذی (BHI ,FB) در روز دوم حفظ کرده است. از آنجا که در شمارش باکتری­ها در محیط کشت غنی شاهد رشد باکتری­ها بودیم، می توان نتیجه گرفت باکتری وارد فاز VBNC نشده است، اما بر اثر شوک دمایی وارده ضعیف شده­ است.

نتیجه بررسی کشت در بلاد آگار در انتهای دوره انجماد
نتایج نشان‌دهنده رشد باکتری تلقیح‌شده از محیط FB در روز شصتم و همولیز مثبت آن در محیط آگار خون‌دار بود.

نتایج بررسی بیان ژن محیط FB در محیط بلاد آگار
نتایج نشان‌دهنده بیان ژن 16S rRNA و بیان مجدد ژن hly بود. در مورد ژن inlA هیچ‌گونه بیانی مشاهده نشد (شکل 5).