year 13, Issue 3 (July - August 2019)                   Iran J Med Microbiol 2019, 13(3): 153-163 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Ahangaran S, Pourbakhsh S A, Abtin A, Asli E. Isolation and Detection of Mycoplasma pneumoniae from Cell Culture by Culture and PCR. Iran J Med Microbiol 2019; 13 (3) :153-163
URL: http://ijmm.ir/article-1-905-en.html
1- Mycoplasma Reference laboratory, Razi Vaccine and Serum Research Institute, Karaj, Iran
2- Mycoplasma Reference laboratory, Razi Vaccine and Serum Research Institute, Karaj, Iran , poursaba@gmail.com
3- Department of Microbiology, Islamic Azad University, Science and Research Branch, Tehran, Iran
Full-Text [PDF 831 kb]   (2554 Downloads)     |   Abstract (HTML)  (9854 Views)
Full-Text:   (3164 Views)
Introduction
Mycoplasmas are microorganisms which lack cell walls, but they have particular sterol plasma membranes (1,2). They are distinctive from other bacteria taxonomically and are in Mollicutes class (15). These days, research laboratories use the cells and cell culture techniques for regenerative medicine (3, 4) and biotechnological productions (1,7). After establishment of cell culture laboratories, contamination of cell cultures with Mycoplasmas have occurred. So, one of the problems in the cell culture is that laboratories could spread Mycoplasmas in all cell cultures, and it could promote between the other cell cultures (5,7). Using unspecific methods to identify Mycoplasmas in cell cultures is not so reliable because Mycoplasmas may not have any cytopathic effect or turbidity in some culture cell lines. Whereas Mycoplasmas could contaminate the cell lines which they are used in manufacturing bioproducts such as vaccination so detecting of these microorganisms in cell lines have been so important and valuable (5,16). Some of the various species of Mycoplasma which could contaminate cell cultures  are Mycoplasma hyorhinis, Acholeplasma laidlawii Mycoplasma pneumoniae (M. pneumoniae), Mycoplasma arginini, Mycoplasma orale and Mycoplasma fermentans (5,12,16).  M. pneumoniae is one of the small microorganisms which could live free in nature. Its size is about 125-250 nm and it grows in cell-free media not so fast. It may be necessary to incubate diphasic media for 2-3 weeks with periodic subcultures onto serum agar plates before an isolate is obtained Furthermore, it appears that the widely used Hayflick medium may not be optimal for the cultivation of all strains of M. pneumoniae.
 
Materials and Methods
Mycoplasma culture
For M. pneumoniae isolation, 82 cell culture samples were collected and cultured in PPLO broth media supplemented. All these samples were analyzed by culture and polymerase chain reaction (PCR) to detect M. pneumoniae. Overall, 82 samples were transferred to Mycoplasma reference laboratory on ice packs. Primarily, the isolated samples were passaged and filtered in fresh PPLO broth then inoculated on PPLO agar medium (BBL, Becton Dickinson and company, Cockeyville, Sparks, MD, USA). Both the broth and agar cultures were incubated at 37 °C in 50% Co2 and 98% humidity (18,20).
DNA Extraction and PCR.
In this study we used a previously described method, with some modifications, for the extraction of DNA by Kojima et al. (18). From each of cell culture samples, 0.5 mL was transferred to Eppendorf tube and centrifuged for 15 min at 13000 rpm. The supernatant fluid was discarded, and the lysis buffer was added to the tube and incubated for at least 4 hours at 56ºC. After that, phenol, phenol, chloroform (1:1) and chloroform were added to the tube individually and respectively and mixed them. Then in each step the tubes were centrifuged at 13000 rpm for 15 min and aqueous layer (top layer) was carefully transferred into a new tube for the following steps. Eventually sodium acetate and ethanol (ETOH) were added in the tubes and mixed well. The tubes were then frizzed in -20ºC for 20 minute and centrifuged for 15 min at 13000 rpm. Finally, 200 µL of 70% ETOH was added and the tubes were centrifuged for 5 min at 13000 rpm. The supernatant was discarded, and the pellet was dried after which 50 µL of distilled water was added to the tubes.
The PCR detection of Mycoplasma genus was performed (18), after that each sample were positive in genus Mycoplasma PCR, were analyzed by the PCR  detection of M. pneumoniae in 543bp fragment by using of MPF and MPR primers which obtained from P1 adhesin gene (10).
 
Results   
Out of the 82 cell cultures samples, 31(37.8%) were positive for Mycoplasma culture, and showing typical Mycoplasma colonies grown on PPLO agar. In addition, 48 (58.5%) samples had positive PCR results for Mycoplasma genus (Figure 1) among which no M. pneumoniae was found (Figure 2) (Tables 1 and 2).

 
 
 
 
    Table 1. Primers for detection of Mycoplasma in genus PCR
M1F 5´-GCTGCGGTGAATACGTTCT -3´
M3R 5´-TCCCCACGTTCTCGTAGGG-3´
 
             Table 2. Primers for detection of M. pneumoniae in PCR
MPF 5'- CAAGCCAAACACGAGCTCCGGCC -3’
PR 5'- CAGTGTCAGCTGTTTGTCCTTCCCC -3’  
 
 
              Table 3. Consequences of culture and PCR surveys for detecting of Mycoplasma genus
Culture PCR Number
Positive Positive 28
Negative Negative 31
Positive Negative 3
Negative Positive 20
Total 82
 
    Table 4. Consequences of culture and PCR surveys for detecting of M. pneumoniae
Method Positive Negative Total
Culture (8/37%)31 (2/62%)51 82
PCR Genus of Mycoplasma (5/85%)48 (5/41%)34 82
M. pneumoniae PCR (0%)0 ( 100%)82 82
 
Figure 1. PCR (MPCR) for detecting of Mycoplasma genus: Analysis of PCR electrophoresis in %1 gel agarose. M: Marker (100bp DNA ladder).Lane C+: Positive control (163bp band, Mycoplasma genus, NCTC 10123). Lane C-: Negative control (uncultured PPLO broth) and Lane 1 to 5 are the Mycoplasma isolates in this study.

 
Figure2. M. pneumonie PCR (MPPCR): Analysis of PCR electrophoresis in %1 gel agarose. M: Marker (100bp DNA ladder).Lane C+: Positive control (M. pneumoniae).Lane C-: Negative control (uncultured PPLO broth) and Lane 1 to 5 are the cell culture samples which were be tested in this study.

 
M. pneumoniae is one of microorganisms which could contaminate of the cell cultures. Whereas cell cultures which could be used in vaccination, so detection of this pathogen from cell cultures could be important. In the present study M. pneumoniae was not isolated and detected from cell culture samples by using culture and PCR assay.
Robinson and coworkers in 1956 detected Mycoplasma in cell culture for the first time when they tried to investigate the consequences of PPLO on Hela cells (24). Mycoplasmas are the contamination of the cell cultures; also, they could change cell cultures’ function, growth, metabolism, morphology. Spread and extension of this microorganism among the cell cultures could damage the cell cultures, change their functions of each cell cultures and create CPE with plaque formation in them (5,12,16). The present study showed that 37.8% of the culture samples were positive for presence of Mycoplasma in culture method and 58.5% of the samples were positive in PCR assay. So according to results of this study PCR method could be more reliable than the traditional methods such as culture for detecting M. pneumoniae in cell culture therefore PCR assay could be an alternative method for detection of M. pneumoniae. It is also recommended to use the novel molecular methods such as Real-Time PCR for the detection of Mycoplasmas in cell cultures since these methods are fast, sensitive, specific and low cost. Also, this study showed that there was no contamination of M. pneumoniae among the cell culture samples referred to the Mycoplasma Reference Laboratory of Razi Institute.

 
Type of Study: Original Research Article | Subject: Molecular Microbiology
Received: 2018/12/26 | Accepted: 2019/06/18 | ePublished: 2019/11/22

References
1. Andrea j, Martin G, Eva L, Klaus J, Gebhard F, Reinhard B, R, Egon M . Submasseteric abscess caused by Mycoplasma salivarium Infection .J.Clin.microbiol. 2008; 46:3860-3862. [DOI:10.1128/JCM.00807-08] [PMID] [PMCID]
2. Freshney RI. Culture of animal cell, Fifth ed, pub, By Wiley-Liss. 2005. [DOI:10.1002/9780471747598]
3. Hans GD, Cord CU. Mycoplasma contamination of cell cultures, incidence, sources, effects, detection, elimination, prevention.Cytotechnology.2002;39:75-90. [DOI:10.1023/A:1022913015916] [PMID] [PMCID]
4. Lincoln CK, Lundin DJ. Mycoplasma Detection and Control. United States Federation for Culture Collections Newsletter. 1990;20 (4):1-3.
5. Mirjalili A, Parmoor E, Moradi Bidhendi S, Sarkari B. Microbial contamination of cell cultures, Biologicals. 2005;33:81-85. [DOI:10.1016/j.biologicals.2005.01.004] [PMID]
6. Matsuura M, Seto K, Watanabe T, Horikawa T. Observations of delayed and immediate hypersensitivity reactions in rabbits inoculated with Mycoplasma salivarium, Mycoplasma orale and Mycoplasma hominis. In Proceedings of the V Annual Congress of the Japanese Society of Mycoplasmology. Japanese Society of Mycoplasmology, Tokyo. 1978: 58-63.
7. Razin S, Yogev D, Naot Y. Molecular biology and pathogenicity of Mycoplasmas. Microbiol Mol Biol Rev. 1998;62:1094-1156.
8. 8-Harasawa, R .Nested PCR: Application to the detection of Mycoplasmas. In Razin S, Tully JG, Editors. Molecular and Diagnostic Procedures in Mycoplasmology. Vol.2.1995. Academic Press, London. 1995;31:710-715.
9. Thomas Prescott A, Mitchell FB, Ken BW. Epidemiology, clinical manifestations, pathogenesis and laboratory detection of Mycoplasma pneumoniae infections. FEMS Microbiol Rev. 2008;32 :956-73. [DOI:10.1111/j.1574-6976.2008.00129.x] [PMID]
10. Chaudhary R, Sharma S, Javed S, Passi K, Dey AB, Malhotra P. Molecular detection of Mycoplasma pneumoniae by quantitative real-time PCR in patients with community acquired pneumonia. Indian J Med Res. 2013;138: 244-251.
11. Mirjalili A, Parmoor E, Moradi Bidhendi S, Sarkari B. Microbial contamination of cell cultures:a 2 years study. Biologicals. 2005;33:81-85. [DOI:10.1016/j.biologicals.2005.01.004] [PMID]
12. Uphoff CC, Brauer S, Grunicke D, Gignac SM, MacLeod RA. Quentmeier. H, Steube K, Tummler M, Voges M, Wagner B, Drexler HG. Sensitivity and specificity of five different Mycoplasma detection assays. Leukemia. 1992;6: 335-341.
13. 13- Arai S, Harasawa R,Ohno T, Takeuchi M, Hikizi K, Uphoff CC, Brauer S, Grunicke D, Gignac SM, MacLeod KN, Lee I, Kato K ,Takahashi H, Okamoto I, RAF, Quentmeier H, Steube K, Tummler M, Vogas M Furudera T. Comparative studies to detect mycoplasma contamination bioindustrial materials for validating standard method. Int. Org. Mycoplasmol. Lett 1994;3:48-49.
14. Robinson LB, Wichelhausen RH, Roizman B. Contamination of human cell cultures by pleuropneumonia-like organisms. Science. 1956;124: 1147-1148. [DOI:10.1126/science.124.3232.1147] [PMID]
15. Kong F, James G, Gordon S, Zelynski A, Gilbert, GL. Species-Specific PCR for Identification of Common Contaminant Mollicutes in Cell Culture, Apl. Environ. Microbiol. 2001; 67:3195-3200. [DOI:10.1128/AEM.67.7.3195-3200.2001] [PMID] [PMCID]
16. Lobo E, Chávez Y, Fernández C, Martinez S, Martinez A. Mycoplasma control in biopharmaccutical processing: Experience of Mycoplasma diagnostic incoba. 14 International congress of the international organization for Mycoplasmology (IOM), Vienna, Austria. 2002.
17. Smith A, Mowles J. Prevention and control of mycoplasma infection of cell cultures. In: Tully, J.G., Razin, S (Editors), Molecular and diagnostic procedures in mycoplasmology. San Diego: Academic Press. 1996: 445-51. [DOI:10.1016/B978-012583806-1/50052-3] [PMCID]
18. Kojima A, Takahashi T, Kijima M, Ogikubo Y, Nishimura Y, Nishimura S, Harasawa R, Tamura Y. Detection of Mycoplasma in avian live virus vaccines by polymerase chain reaction. Biologicals. 1997;25:365-71. [DOI:10.1006/biol.1997.0108] [PMID]
19. Rawadi G, Dussurget O. Advances in PCR-based detection of Mycoplasmas contaminating cell cultures. PCR Methods and Applications. 1995;4:199-208. [DOI:10.1101/gr.4.4.199] [PMID]
20. Fazli A, Pourbakhsh SA, Asli E, Hadadi A. Decetion of Mycoplasma 0rale contaminmination in cell culture by PCR method. Iran J Med Microbiol.2013; 7(2):7-14.
21. ‏Rostamizadeh V, Pourbakhsh SA, Asli E, Hadadi A. Decetion salivarium contaminiation in cell culture using PCR method. Modares Journal Of Medical Sience. 2013;16(3):109-118.
22. Hopert A, Uphoff CC, Wirth M, Hauser H, Drexler HG. Specificity and sensitivity of polymerase chain reaction (PCR) in comparison with other methods for the detection of mycoplasma contamination in cell lines. J. Immunol. Methods.1993; 164: 91-100. [DOI:10.1016/0022-1759(93)90279-G]
23. Spaepen M, Angulo AF, Marynen P, Cassiman JJ. Detection of bacterial and Mycoplasma contamination in cell cultures by polymerase chain reaction, FEMS Microbiol Lett. 1992:Nov 15;78(1): 89-94. [DOI:10.1111/j.1574-6968.1992.tb05547.x]
24. Stormer M, Vollmer T, Henrich B, Kleesiek K, Dreier J. Broad-range real-time PCR assay for the rapid identification of cell-line contaminants and clinically important mollicute species. 2009;299:291-300. [DOI:10.1016/j.ijmm.2008.08.002] [PMID]
25. Georges R, Olivier D. Advances in PCR-based detection of Mycoplasma contamination cell cultures. Spring. 2011;4:199-208. [DOI:10.1101/gr.4.4.199] [PMID]
26. Shah hosseini MH, Gharib doust F, Allahyary E, khoram Khourshid HR, Vand Yusefi J. Detection of Mycoplasma DNA In Rheumatoid Arthritis Patients serum by PCR Journal Of Medical Council Of I.R.I. 2007; 25(2): 178 To 191.
27. Santos LM, Melshor C, Mettifogo E, Timenetsky J. Detection of Mycoplasma from cell culture by PCR and culture. 14 International congress of the international organization for myplas mology (IOM), Vienna, Austria. 2002.
28. Ohno T, Kudo T, Takeuchi M, Mizusawa H. Mycoplasma control in biopharmaccutical processing:Experiences of public cell bank in japan. 13 International congress of Iom, Fakuoka, Japan. 2000.
29. Timenetsky J, Santos LM, Buzinhani M. Mettifogo E. Detection of multiple Mycoplasma infection in cell cultures by PCR .Brazilian journal of medical and Biological research. 2006;39:907-914. [DOI:10.1590/S0100-879X2006000700009] [PMID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc