year 17, Issue 5 (September - October 2023)                   Iran J Med Microbiol 2023, 17(5): 559-570 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Zaid Tariq Ahmed R, Mujahid Abdullah R. Prevalence of Multidrug Resistant Staphylococcus aureus and their Pathogenic Toxins Genes in Iraqi Patients, 2022-2023. Iran J Med Microbiol 2023; 17 (5) :559-570
URL: http://ijmm.ir/article-1-2090-en.html
1- Department of Biology, College of Education for Pure Science (Ibn Al-Haitham), University of Baghdad, Baghdad, Iraq
2- Department of Biology, College of Education for Pure Science (Ibn Al-Haitham), University of Baghdad, Baghdad, Iraq , dr.ranamujahid@gmail.com
Full-Text [PDF 822 kb]   (1362 Downloads)     |   Abstract (HTML)  (2985 Views)
Full-Text:   (935 Views)
Introduction


Staphylococcus aureus, a Gram positive, coagulase-positive pathogen belonging to the family Staphylococcaceae, and it is the most prevalent in terms of its pathogenicity to humans (1). Toxins are one of the most important substances that prevent S. aureus from invading host cells and disease occurrence. They have high molecular weight and play an important role in disrupting the physiological functions and developing the infection in the host. Toxins in S. aureus are divided into three groups, including the group of superantigens (Sags) that cause toxic shock syndrome (TSST), enterotoxins (SEs), exfoliative toxins (ETs) that cause Staphylococcal scalded skin syndrome (SSSS) and a group of cytotoxins that cause decomposes host cells by creating holes in cell membranes, include leukotoxins, α-hemolysin, β-hemolysin and γ-hemolysin (2).
In hospitals, the S. aureus bacteria is one of the most significant contributors to wound and burn infections. It can also cause minor skin infections, severe tissue infections, and sepsis, and this bacterium can infect the body’s organs and cause diseases such as acute endocarditis. It can sometimes lead to fatalities and skin conditions characterized by abscesses, inflammation of hair follicles, and the development of pimples caused by these bacteria. Moreover, Kawasaki disease occurs in children, especially in developing countries, leading to vasculitis, which can have a significant impact on the coronary arteries. It can also affect older people, particularly those with AIDS (3, 4).
Staphylococcus aureus enhances pathogenicity by producing some enzymes and toxins. These agents include exfoliative toxins secreted by certain strains of S. aureus bacteria. Exfoliative toxins consist of two serotypes: exfoliative toxin A, encoded by the eta gene carried on the phage genome and thermally stable, and exfoliative toxin B, encoded by plasmid-borne gene etb, which is destroyed by heat. Some studies indicate the existence of the tertiary serotype (toxin D). Exfoliative toxin D pattern encoded by the etd gene that separates the epidermis layers in places of infection because of its ability to lyses protein and dissolve polysaccharides in the intercellular of the skin, causing exfoliate and then death and also inflammation in the skin cell membranes (5).
One of the extracellular toxins that S. aureus secretes is Pantone Valentine leukocidin (PVL). It was first discovered in 1894 by the scientist Van de Velde. In 1932. One of the most important factors of virulence in the S. aureus resistant to methicillin MRSA acquired in the community by its effect on multinucleated blood cells, which is a multicomponent protein toxins that works to break down the membranes, causing holes in the membrane of granulocyte and phagocytic membrane and thus causes the killing of white blood cells for humans and rabbits, and that the mechanism of this poison includes a change in the permeability of potassium ion, which leads to the entry of substances into the cell and works to form holes in the plasma membrane, which leads to the decomposition of cells and the exit of cytoplasm granules (6). Most strains of Staphylococcus aureus isolated from patients produce toxic shock syndrome toxin, a single polypeptide chain; the coding gene test has a molecular weight of approximately 22 kDa. In 1980, it was discovered in the United States that it is the leading cause of toxic shock syndrome and causes multiple infections. This toxin works in association with MHC Class II and with T cell receptors and thus leads to the activation of T cells to secrete vast amounts of cytokines such as (IL-8, IL-2, and TNF), and this is called indirect effect because it possesses superantigen qualities. The direct effect as a result of the interaction of the poison with T cells and endothelial cells thus leads to a disease known as toxic shock syndrome. Its symptoms include high temperature, low blood pressure, rash, peeling and muscle peeling, circulatory failure, diarrhea, vomiting, peeling of the skin, and hypoalbuminemia and causes many complications such as inflammation of the lungs, lung abscesses, and urinary tract infections UTI. If treatment is not done after a period of the onset of symptoms, toxic shock may occur. Kill him after 24 hours (7). Hence, the study aims to detect some toxin genes and analyze nucleotide sequences in some S. aureus isolates.


 

Materials and Methods

2.1. Collection, Isolation and Detection of Bacteria
In this cross-sectional study, 220 samples were randomly collected: 30 samples of urinary tract infection, 50 samples of wounds, 40 samples of burns, 30 samples of sputum, and 70 samples of cervix. The samples were collected from several hospitals in Baghdad: educational laboratories, Baghdad Teaching Hospital, Shaheed Ghazi Al-Hariri Hospital for Specialized Surgery, and Burns and Wounds Hospital /Medical City from October 1st, 2022, to January 1st, 2023. The samples were cultured in blood agar media and mannitol salt agar and then were incubated at 37°C for 24 hours. The VITEK system and 16srRNA PCR did the final detection. The bacteria that had the mecA gene were considered resistant to Methicillin. The PCR temperature cycling for mecA gene detection and toxin genes is shown in Table 1.
2.2. Antibiotic Susceptibility Test
The VITEK-2 (bioMérieux, USA) was used to determine the sensitivity of S. aureus isolates to 15 antibiotics. These include: Benzylpenicillin, Oxacillin, and Fusidic acid, Linezolid, Gentamicin, Ciprofloxacin, Moxifloxacin, Erythromycin, Teicoplanin, Clindamycin, Rifampicin, Vancomycin, Tetracycline, Tigecycline and Trimethoprim / Sulfamethoxazole.
2.3. DNA Isolation
DNA was extracted from the bacterial isolates under study using a Zymo (USA) Genomic DNA Extraction kit (Zymo Research, USA, R2014(50prep) following the manufacturer's instructions (8).
2.4. Molecular Detection of Toxin Genes for S. aureus
This study used PCR to detect the toxins' genes, including Luk S/F, Luk E/D, tst, eta, etb, etd, as shown in Table 1. According to the manufacturer (Integrated DNA Technologies Company, Canada), the reaction mixture for diagnosing the genes consisted of 25 μL for each reaction, which included 1.5 μL of DNA template, 1μL of primer Forward, 1 μL of primer Reverse, 100 μL Concentration   and 16 μL of ion-free distilled water and 5 μL GO Tag green master mix. The following program was used to determine the reaction conditions, with some modifications, as shown in Table 2 (8).


Table 1. The PCR optimum temperature condition for detection is 16srRNA, mecA gene, and toxin genes.

No. Phase Tm (ᵒC) Time No. of cycle
1 Initial Denaturation 94ᵒC 5 min 1
2 Denaturation 94ᵒC 45 Sec 35
3 Annealing 45 sec
16 srRNA                                57ᵒC
MecA                                      56ᵒC
LukS/F 55ᵒC
LukE/D 55ᵒC
Tst 55ᵒC
eta 57ᵒC
etb 57ᵒC
etd 57ᵒC
4 Extension 72ᵒC 1 min
5 Extension -2 72ᵒC 7 min 1



Table2. Size amplicon and the sequence of oligonucleotide primers.

Reference Product Size (bp) Initial Sequence From 5′ to 3′ Target gene
(8) 756 F-5′- AACTCTGTTATTAGGGAAGAACA -3′ 16srRNA
R-5′- CCACCTTCCTCCGGTTTGTCACC -3′
(9) 310 F-5′- GATGAAATGACTGAACGTCCGATAA-3′ mecA
R-5′- CCAATTCCACATTGTTTCGGTCTAA-3′
(9) 433 F-5′- ATCATTAGGTAAAATGTCTGGACATGATCCA-3 LukS/F
R-5′- GCATCAAGTGTATTGGATAGCAAAGC-3
(9) 269 F-5′- TGAAAAAGGTTCAAAGTTGATACGAG -3′ LukE/D
R-5′- TGTATTCGATAGCAAAAGCAGTGCA -3′
(10) 326 F-5′- ACCCCTGTTCCCTTATCATC-3′ tst
R-5′- TTTTCAGTATTTGTAACGCC -3′
(11) 494 F- 5′- TTTGCTTTCTTGATTTGGATTC-3′ eta
R-5′- GATGTGTTCGGTTTGATTGAC -3′
(10) 226 F-5′- ACAAGCAAAAGAATACAGCG -3′ etb
R-5′- GTTTTTGGCTGCTTCTCTTG -3′
(12) 193 F-5′- CGGAAAGTCTGCAGGTGATT -3′ etd
R-5′- TCCAGAATTTCCCGACTCAG-3′


2.5. Gel Electrophoresis
Bio Basic INC (Canada) was used at a concentration of 2% in 5 μL of Red Safe Nucleic Acid Staining Solution. Then, DNA ladders containing between 100 and 1500 base pairs and a voltage difference of 5 volts for an hour. UV light from Optima (Japan) was used for imaging.
2.6. DNA Sequencing
PCR Product reaction of LukS/F-PV, LukD/E, eta, and etd, with forward primer and reverts primer genes, was sent to Macrogen Inc (South Korea Geumchen, Seoul). The results were read and analyzed using the BioEdit sequence Alignment Editor Software DNASTER (Madison, WI, USA), which can be found on the website of the National Center for Biotechnology Information (NCBI) at the following link (http://www.ncbi.nlm.nih.gov). Protein translation was performed using the Cluster Omega program to identify the number and type of mutations and their impact on protein translation, available on the https://www.ebi.ac.uk/Tools/msa/clustalo website (13).

 
 

Results

3.1. Clinical Samples Source and Detection
 Two hundred twenty samples were collected from various clinical cases, including genders, different age groups, and several hospitals in Baghdad. The frequency of sample by type and distribution of S. aureus by age and gender are shown in Table 3. Finally, 50 samples were determined by 16srRNA PCR as S. aureus.


Table 3. Source and distribution by age groups of S. aureus isolates.

Source of isolate Number of isolates Percentage%
Urine 10 20%
1-10 year 0 0.0%
10-20 year 1 2%
20-30 year 1 2%
More 30 year 8 16%
Wounds 12 24%
1-10 year 0 0.0%
10-20 year 0 0.0%
20-30 year 0 0.0%
More 30 year 12 24%
Cervicitis 8 16%
1-10 year 2 4%
10-20 year 1 2%
20-30 year 0 0.0%
More 30 year 2 4%
Burns 15 30
1-10 year 0 0.0%
10-20 year 0 0.0%
20-30 year 0 0.0%
More 30 year 15 30%
Sputum 5 10%
1-10 year 0 0.0%
10-20 year 0 0.0%
20-30 year 2 4%
More 30 year 6 12%
Total number 50 100%

3.2 Molecular Detection and Confirmation of S. aureus Isolates
To confirm the results of the cultural diagnosis, microscopic, Vitek-2 compact system, the molecular diagnosis of S. aureus isolates was performed by PCR technique using specific primers for the16SrRNA gene. The results showed that all S. aureus isolates (50) had a positive gene result (Table 4).


Table 4. Source and number of genes possessed by S. aureus

No Source Diagnostic gene Virulence genes
16srRNA
No. (%)
mecA
No. (%)
LukS
No. (%)
lukE
No. (%)
Tst
No. (%)
eta
No. (%)
etb
No. (%)
etd
No. (%)
1 UTI 10(20) 10(20) 7(14) 10(20) 0 10(20) 0 9(18)
2 Wounds 12(24) 12(24) 11(22) 12(24) 0 12(24) 0 10(20)
3 Cervicitis 8(16) 8(16) 5(10) 8(16) 8(16) 8(16) 0 8(16)
4 Burns 15(30) 15(30) 6 (14) 15(30) 9(18) 15(30) 0 15(30)
5 Sputum 5(10) 5(10) 5(10) 5(10) 4 (8) 5(10) 0 5(10)

3.3. Methicillin Resistance Prevalence
The PCR result to detect the mecA gene showed that all 50 (100%) S. aureus strains harbored the mecA gene and were considered MRSA (Table 5).
3.4. Antibiotics Susceptibility Prevalence
The current study demonstrated that S. aureus isolates exhibited the highest resistance to Benzylpenicillin at 100%, followed by Erythromycin at 78%, Oxacillin at 76%, and Clindamycin at 74%. In contrast, the remaining antibiotics showed resistance rates of 42% for Ciprofloxacin, 40% for Moxifloxacin, 20% for Gentamycin, 40% for Tetracycline, 14% for Fusidic Acid, 6% for Rifampicin, and 14% for Trimethoprim/Sulfamethoxazole. The isolates showed less resistance to Vancomycin, Linezolid, and Teicoplanin at 5%, 2%, and 2%, respectively. Tigecycline displayed a sensitivity rate of 100%, as shown in Figure 1.
3.5 Multidrug Antibiotics Resistant (MDR) Patterns
The results showed that there are 10 different patterns of S. aureus resistance against the fifteen antibiotics, as shown in Table 5. The current study demonstrated that 80% of S. aureus isolates exhibited multiple drug resistance (MDR).

                           
Table 5. The Profile of multiple antibiotic resistances among S. aureus isolates.

Number of isolates MDR Types of resistances Antibiotic type
2(4%) 2 Ben, Oxa, Genta, Moxi, Cip, Eryth, Clind, Fusid, Tet, Rifam, Trime Antibiotype1
Resistant for 11 antibiotics
1(2%) 1 Ben, Oxa, Cip, Moxi, Eryth, Clind, Tet, Genta, Linez, Teico Antibiotype2
Resistant for 10 antibiotics
1(2%) 1 Ben, Oxa, Genta, Moxi, Cip, Eryth, Clind, Tet, Fusid Antibiotype3
Resistant for 9 antibiotics
4(8%) 4 Ben, Oxa, Cip, Moxi, Eryth, Clind, Tet, Genta Antibiotype4
Resistant for 8 antibiotics
7(14%) 7 Ben, Oxa, Cip, Moxi, Eryth, Clind, Tet Antibiotype5
Resistant for 7 antibiotics
4(8%) 4 Ben, Oxa, Cip, Moxi, Eryth, Clind Antibiotype6
Resistant for  6 antibiotics
5(10%) 5 Ben, Oxa, Eryth, Clind, Tet Antibiotype7
Resistant for 5 antibiotics
1(2%) 1 Ben, Oxa, Eryth, Clind Antibiotype8
Resistant for 4 antibiotics
15(30%) 15 Ben, Eryth, Clind Antibiotype9
Resistant for 3 antibiotics
7(14%) 0 Ben, Oxa Antibiotype10
Resistant for 2 antibiotics
40 (80 %) Total number

Oxa: Oxacillin, Genta: Gentamicin, Cip: Ciprofloxacin, Moxi: Moxifloxacin, Eryth: Erythromycin, Ben: Benzylpenicillin, Clind: Clindamycin, Linez: Linezolid, Teico: Teicoplanin, Vanco: Vancomycin, Tet: Tetracyclin, Tige: Tigecycline, Fusid: Fusidic acid, Rifam: Rifampicin, Trime: Trimethoprim/ Sulfamethoxazole

Figure 1. Antibiotic resistant percentage of S. aureus isolates
Figure 1. Antibiotic resistant percentage of S. aureus isolates

3.6 Detection of Leucocidin and Toxic Shock Syndrome Toxin
The genes of toxins possessed by S. aureus bacteria were detected: Luks/F-PV, LukE/D that 34 (68%) isolated belong to S. aureus bacteria possesses the gene Luks/F-PV. The investigation results of the LukE/D-PV gene indicate that all 50 (100%) isolated samples belonging to S. aureus isolates possess the gene LukE/D-PV, and 21 (42%) isolates harbored the test gene (Table 4).
3.7 Detection of Exfoliative Toxins
The current study revealed that all 50(100%) S. aureus isolates possessed the eta gene and tested negative for the etb gene. Moreover, 47 (94%) S. aureus isolates were found to carry the etd gene (Table 4).
3.8 DNA Sequencing
The analysis of the four toxins genes (Tst, LukE/D, LukS/F, etc.) showed no genetic mutations, and the match rate was 100% except for the eta gene, as shown in Figure 2.
3.7. GeneBank accession numbers  
The DNA sequences of the partial eta gene from the representative isolates have been deposited in the GenBank database under accession numbers OQ557480 at the following link:  https://www.ncbi.nlm.nih.gov/nuccore/OQ557480


Table 6. Changes in nitrogen bases and their effect on the translation of the eta gene's amino acid for isolated S. aureus.

No. Nitrogen bases Change in the nitrogen base Site Amino acid Change in amino acids
1 Thymine Cytosine 1145213 Lysin lysin
2 Cytosine Thymine 1145192 Methionine Methionine
3 Guanine Cytosine 1145025 Cysteine Serine


Figure 2. Analysis of multiple sequences of the reference eta gene with isolates of S. aureus using BioEdit Sequence Alignment Editor Software

Figure 2. Analysis of multiple sequences of the reference eta gene with isolates of S. aureus using BioEdit Sequence Alignment Editor Software

 
 

Discussion

S. aureus is one of the most prevalent bacterial pathogens. It can infect both healthy individuals and those with underlying health conditions, leading to numerous severe infections worldwide each year (14).
In this study, Table 3, the prevalence of S. aureus in burn infection was found to be 30%, similar to other studies (15), which found that the highest rate of S. aureus in wound infections was 59%, and in other studies (16, 17). it was similar to the current research. The study found that the highest percentage of S. aureus isolates was found in males (54%) and females (46%), respectively; (18, 19) stated that the highest prevalence rate of S. aureus in females 44% and 22.6%, respectively compared to males 20% and 56% respectively. The first result was much lower than in this study, while the second was similar. The patients were classified into different age groups from one year to 30 years, and as shown in Table 3, the highest prevalence of S. aureus in the age group between (30 years and over). The result of the current study differed from the study (20) in that the highest incidence rate in the age groups between 1-20 years was (45.1%) followed by the age groups 41-60 years (29.4%). The reason for the different percentage of isolation of S. aureus isolates and infection between age groups may be due to several factors, including the time of collecting samples, geographical location, source of isolation, the number of samples, the duration of their stay in the hospital, the health status of patients, their chronic diseases and other diseases, and the treatment used.
In this study, S. aureus isolates showed less resistance to Vancomycin, Teicoplanin, Linezolid Rifampicin, and Fusidic Acid, as shown in Figure 1, and all isolates were sensitive to Tigecycline, which supports the findings of several studies (18, 21-24). S. aureus susceptibility to these antibiotics can be linked due to their low use, high costs, low market availability, and toxic side effects (25). The pattern of sensitivity to other antibiotics to S. aureus isolates was similar to other studies where the most commonly used antibiotics, such as Benzylpenicillin, Oxacillin, and Gentamycin, were included. The isolates showed high antibiotic resistance, identical to many studies (20, 22, 26, 27). The reason may be due to the bacteria having several mechanisms to resist these antibiotics, including the generation of intrinsic resistance and the modification of the target site Penicillin-linked proteins (PBps) as well as the production of β-Lactamase enzymes, the degradation of beta-lactam (β-lactam) antagonists, possessing the three modified enzymes aminoglycoside acetyltransferase (AACs), aminoglycoside-Nucleotidyltransferases (ANTs) and aminoglycoside phosphotransferase (APHs) and encoding genetic elements resulting in bacterial resistance to aminoglycoside antagonists (28, 29).
In contrast, other studies, including (30, 31), showed that S. aureus isolates appeared less resistant to clindamycin and gentamicin, possibly due to the low frequency of antibiotics used in the population studied and the source of isolates.
In this study, S. aureus isolates showed moderate resistance to ciprofloxacin and moxifloxacin antibiotics, which was compatible with several studies (20, 26, 32). The reason for this resistance may be due to several mechanisms, including the possession of flush pump bacteria such as NorA encoded for the NorA gene, a change in the permeability of the antibiotic, or mutations in the DNA gyrase encoded for the gryA and gry B genes and mutations in topoisomerase encoded for the ParC and ParE genes that confer resistance to Fluoroquinolone antibiotic (33).
Accordingly, the results shown in Table 5 indicate that 40 (80%) of S. aureus isolates show multiple resistance to various types of antibiotics used in this study. The results showed that 40 isolates have the highest multi-resistance to antibiotics, representing 4(8%) of the isolates showing resistance to eight antibiotics. Also, 1(2%) isolate has the lowest multi-resistance, which is resistant to four antibiotics only. Moreover, the highest percentage was observed in the isolates that exhibit resistance to three antibiotics, represented in 15(30%). The result of the study differed from (34), which reported that S. aureus exhibited six distinct antibiotic resistance patterns. Our MDR result agrees with previous studies conducted in (23), which found that S. aureus is resistant to multiple antibiotics by 71.8%. MDR patterns vary between studies and can be linked to many factors, including the source of isolation, their ability to avoid the effects of antibiotics, and differences in antibiotic concentration. Several studies have identified bacterial sources as an essential determinant of MDR (35).
 Many researchers corroborated this by using the 16SrRNA gene to diagnose S. aureus species and distinguish it from other species (10). They explained using the same gene to confirm that the 16SrRNA gene is one of the conversed genes carried on the chromosome, which has a length of 720 base pairs and consists of 239 amino acids. It is used in genetic diagnosis and finding an evolutionary relationship between organisms and bacteria due to evolution and variation at low rates in the genetic region, which is the diagnosis of S. aureus (36).
mecA is an emerging gene responsible for Staphylococcal methicillin resistance. In the current study, Figure 2, the prevalence rate of the mecA gene among S. aureus isolates was 100% in line with many studies (37, 38), showing that all isolates gave a positive result for the gene. Our results sharply contradicted the evidence published in local research in Iraq, which found that 10 isolates (11.11%) possess the gene. This may be because all isolates in the current study have a gene that is carried on a  mobile cassette Chromosome (SSCmec), enters the S. aureus chromosome, combines with it, and then mediates resistance to methylene antibodies and several beta-lactam antagonists (39). Studies have indicated that the absence of the mecA gene among S. aureus isolates may be due to their possession of other diverse cassette genes encoded to other genes, such as mecD, mecB, and mecC genes (40).
 For the potential to produce leucocidin toxin, we measured the prevalence of lukE/D in S. aureus isolates, and we found that the rate of prevalence was significantly higher by 100% compared to the report (41) who found that 63(82.8%) out of a total of 79 isolates possessed LukD/E gene. However, it differed from the results of (42), which indicated that 17 (51.5%).
The superantigen TSST-1 is an extracellular protein that causes toxic shock syndrome and is encoded by the tst gene (7). tst encoded by a highly mobile pathogenicity island (SaPI) (43). Our results showed tst prevalence rates of 21(42%) in S. aureus isolates.  These rates agreed with (35, 44), who recorded (44 % and 46.7%) in Iraq.
Exfoliative toxins, encoded by eta and etb genes, etd are responsible for skin and cutaneous tissue infections and scalded skin syndrome (45). In this study, neither etb were found in S. aureus isolates. This is similar to S. aureus strains in Iran (11). They reported that eta, etb, and etd genes were present in 115(76.7%), 25(16.7%), and 81(54%) of S. aureus isolates, respectively. While 92% of S. aureus isolates carried the etb gene, eta was not detected (46). The result of the current study differed from these findings.
The results of the sequencing analysis of the eta gene, as shown in Figure 2, Table 6, the presence of silent mutations showed that this type of mutation occurs when the substitution of a single nitrogen base in the DNA results in a new genetic code that encodes the same original amino acid that did not affect the protein sequence and the change of amino acids, in addition to the presence of mutations of another type called missense mutations, this type of mutation occurs either one change of the genetic code of the resulting protein or an acid change One amino for the resulting protein (47).
The results were inconsistent with the findings of (48) when analyzing the DNA sequence of the eta gene in S. aureus, as it was found that there were no genetic mutations.


 

Conclusion

All S. aureus isolates had the mecA gene for methicillin resistance and showed high resistance to Benzylpenicillin and less resistance to Vancomycin, Linezolid, and Teicoplanin antibiotics. The results of the detection of the toxin genes showed that S. aureus possessed each of the toxin genes Luks/F-PV, LukD/E-PV, tst, eta, and etd, while all isolates under study did not have the etb gene. The sequencing analysis results of the eta gene indicated the presence of silent mutations that did not impact protein translation, alongside other mutations that resulted in alterations to the arrangement of amino acids and protein translation.

 

Acknowledgment

Further molecular techniques are needed to study S. aureus's other virulence and antibiotic resistance genes, the effect of mutations on these genes, and their role in bacterial pathogenesis.

 

Ethics Approval

The samples were gained according to Local Research Ethics Committee approval in Iraqi Ministry of Health No. 47737 on 13/11/2022.


 

Conflicts of Interest

The authors declare no conflict of interest.


 

Author Contributions

R.Z: Experimental studies, data collection, Manuscript preparation, editing.
R.M.: Experimental Design, Manuscript review, and final decision of the manuscript


 

Funding

No funding.

 
 

Type of Study: Original Research Article | Subject: Microbial Genetics
Received: 2023/08/4 | Accepted: 2023/11/17 | ePublished: 2023/11/29

References
1. Gnanamani A, Hariharan P, Paul-Satyaseela M. Staphylococcus aureus: Overview of bacteriology, clinical diseases, epidemiology, antibiotic resistance and therapeutic approach. Frontiers in Staphylococcus aureus. 2017;4(28):10-5772. [DOI:10.5772/67338] [PMCID]
2. Kim M-K. Staphylococcus aureus Toxins: From Their Pathogenic Roles to Anti-virulence Therapy Using Natural Products. Biotechnol Bioprocess Eng. 2019;24(3):424-35. [DOI:10.1007/s12257-019-0059-9]
3. Suarez JF, Ong'uti S, Holubar M. Select controversies in the management of methicillin-resistant Staphylococcus aureus bacteremia: answers and remaining questions from recent evidence. Fac Rev. 2021;10(66). [DOI:10.12703/r/10-66] [PMID] [PMCID]
4. Pomorska K, Jakubu V, Malisova L, Fridrichova M, Musilek M, Zemlickova H. Antibiotic resistance, spa typing and clonal analysis of methicillin-resistant Staphylococcus aureus (MRSA) isolates from blood of patients hospitalized in the Czech Republic. Antibiotics. 2021;10(4):395. [DOI:10.3390/antibiotics10040395] [PMID] [PMCID]
5. Bennett MR, Thomsen IP. Epidemiological and clinical evidence for the role of toxins in S. aureus human disease. Toxins. 2020;12(6):408. [DOI:10.3390/toxins12060408] [PMID] [PMCID]
6. Divyakolu S, Chikkala R, Ratnakar KS, Sritharan V. Hemolysins of Staphylococcus aureus-An update on their biology, role in pathogenesis and as targets for anti-virulence therapy. Adv Infect Dis. 2019;9(2):80-104. [DOI:10.4236/aid.2019.92007]
7. Rasheed NA, Hussein NR. Staphylococcus aureus: an overview of discovery, characteristics, epidemiology, virulence factors and antimicrobial sensitivity. Eur J Mol Clin Med. 2021;8(3):1160-83.
8. Mahdi AA, Abdullah RM. Molecular study of Carbapenime resistant genes in Acinetobacter baumannii that isolated from different clinical cases. Biochem Cell Arch. 2020;20(1):1605-10.
9. McClure J-A, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococci. J Clin Microbiol. 2006;44(3):1141-4. [DOI:10.1128/JCM.44.3.1141-1144.2006] [PMID] [PMCID]
10. Pavithra KG, P SK, V J, P SR. Removal of colorants from wastewater: A review on sources and treatment strategies. J Ind Eng Chem. 2019;75:1-19. [DOI:10.1016/j.jiec.2019.02.011]
11. Mehrotra M, Wang G, Johnson Wendy M. Multiplex PCR for Detection of Genes forStaphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. J Clin Microbiol. 2000;38(3):1032-5. [DOI:10.1128/JCM.38.3.1032-1035.2000] [PMID] [PMCID]
12. Mohseni M, Rafiei F, Ghaemi EA. High frequency of exfoliative toxin genes among Staphylococcus aureus isolated from clinical specimens in the north of Iran: Alarm for the health of individuals under risk. Iran J Microbiol. 2018;10(3):158-65.
13. Hussain EA, Qasim Hameed H, Mujahid Al-Shuwaikh A, Mujahid Abdullah R. Detection of the aadA1 and aac (3)-1V resistance genes in Acinetobacter baumannii. Arch Razi Inst. 2022;77(3):959-66.
14. Cheung GYC, Bae JS, Otto M. Pathogenicity and virulence of Staphylococcus aureus. Virulence. 2021;12(1):547-69. [DOI:10.1080/21505594.2021.1878688] [PMID] [PMCID]
15. Goudarzi M, Bahramian M, Satarzadeh Tabrizi M, Udo EE, Figueiredo AMS, Fazeli M, et al. Genetic diversity of methicillin resistant Staphylococcus aureus strains isolated from burn patients in Iran: ST239-SCCmec III/t037 emerges as the major clone. Microb Pathog. 2017;105:1-7. [DOI:10.1016/j.micpath.2017.02.004] [PMID]
16. Mahdi EA, Al-Shaibani AB, Zbar NS. The impact of Glucose and Sodium Chloride on the Biofilm Formation of Pseudomonas aeruginosa & Staphylococcus aureus. Ibn al-Haitham j Pure Appl Sci. 2020;33(4):1-9. [DOI:10.30526/33.4.2525]
17. Lamichhane A, Nakarmi KK, Dahal P, Basnet SJ, Pokharel PB, Bhattarai S, et al. Bacteriological profile of burn patients and antimicrobial susceptibility pattern of their wound isolates at nepal cleft and burn center. J Coll Med Sci Nepal. 2019;15(3):160-6. [DOI:10.3126/jcmsn.v15i3.24363]
18. Khan AA, Ali A, Tharmalingam N, Mylonakis E, Zahra R. First report of mecC gene in clinical methicillin resistant S. aureus (MRSA) from tertiary care hospital Islamabad, Pakistan. J Infect Public Health. 2020;13(10):1501-7. [DOI:10.1016/j.jiph.2020.05.017] [PMID]
19. Mitiku A, Aklilu A, Biresaw G, Gize A. Prevalence and Associated Factors of Methicillin Resistance Staphylococcus aureus (MRSA) Among Urinary Tract Infection Suspected Patients Attending at Arba Minch General Hospital, Southern Ethiopia. Infect Drug Resist. 2021;14(null):2133-42. [DOI:10.2147/IDR.S306648] [PMID] [PMCID]
20. Rasmi AH, Ahmed EF, Darwish AMA, Gad GFM. Virulence genes distributed among Staphylococcus aureus causing wound infections and their correlation to antibiotic resistance. BMC Infect Dis. 2022;22(652). [DOI:10.1186/s12879-022-07624-8] [PMID] [PMCID]
21. Ogaidi BM, Al-Jobori KM, Ghareeb AM. Green Synthesis Of Silver Nanoparticles By Ricinus Communis And Investigate Its Antibacterial Potential Against Methicillin-Resistant Staphylococcus Aureus (Mrsa). Biochem Cell Arch. 2021;21(2):3731-40.
22. Ahmed ZF, Al-Daraghi WAH. Molecular Detection of medA Virulence Gene in Staphylococcus aureus Isolated from Iraqi Patients. Iraqi J Vet Sci. 2022;21(1):8-18.
23. Mohammadi A, Goudarzi M, Dadashi M, Soltani M, Goudarzi H, Hajikhani B. Molecular Detection of Genes Involved in Biofilm Formation in Staphylococcus aureus Strains Isolates: Evidence From Shahid Motahari Hospital in Tehran. Jundishapur J Microbiol. 2020;13(7):e102058. [DOI:10.5812/jjm.102058]
24. Mohammed AS, Al-Kazaz AKA, Zaidan IA. Effect the combination of antibiotics on clinical isolates of Staphylococcus aureus. Baghdad Sci J. 2009;6(4):683-92. [DOI:10.21123/bsj.6.4.683-692]
25. Mama M, Abdissa A, Sewunet T. Antimicrobial susceptibility pattern of bacterial isolates from wound infection and their sensitivity to alternative topical agents at Jimma University Specialized Hospital, South-West Ethiopia. Ann Clin Microbiol. 2014;13(14). [DOI:10.1186/1476-0711-13-14] [PMID] [PMCID]
26. Alkaabi SAG. Bacterial isolates and their antibiograms of burn wound infections in Burns Specialist Hospital in Baghdad. Baghdad Sci J. 2013;10(2):331-40. [DOI:10.21123/bsj.10.2.331-340]
27. Motamedi H, Asghari B, Tahmasebi H, Arabestani MR. Adhesion factors and association with antibiotic resistance among clinical isolates of Staphylococcus aureus. Iran J Microbiol. 2017;11(3):27-36.
28. Dinescu Ş C, Bărbulescu AL, Firulescu SC, Chisălău AB, Pârvănescu CD, Ciurea PL, et al. Staphylococcus aureus-induced septic arthritis of the ankle related to malum perforans in a diabetes patient. Rom J Morphol Embryol. 2021;62(2):615-9. [DOI:10.47162/RJME.62.2.31] [PMID] [PMCID]
29. Nomura R, Nakaminami H, Takasao K, Muramatsu S, Kato Y, Wajima T, et al. A class A β-lactamase produced by borderline oxacillin-resistant Staphylococcus aureus hydrolyses oxacillin. J Glob Antimicrob Resist. 2020;22:244-7. [DOI:10.1016/j.jgar.2020.03.002] [PMID]
30. Akrae DK, Al-Ahmer SD, Ghareeb AM. Association of Biofilm Production Involved Icaa Gene and Antibiotic Resistance Profile With Ocular Infections Incidence Caused by Staphylococcus Aurous. Biochem Cell Arch. 2021;21(1):631-7.
31. Gurung RR, Maharjan P, Chhetri GG. Antibiotic resistance pattern of Staphylococcus aureus with reference to MRSA isolates from pediatric patients. Future Sci OA. 2020;6(4):FSO464. [DOI:10.2144/fsoa-2019-0122] [PMID] [PMCID]
32. Mahdi Al-Buhilal JA, Saad M, Al-Rubaey NKF. Molecular Detection Of Erma, Ermb And Ermc Genes Among Methicillin Resistant Staphylococcus Aureus Isolated From Patients With Ocular Infections. Biochem Cell Arch. 2021;21(1):1443-8.
33. Prabhoo R, Chaddha R, Iyer R, Mehra A, Ahdal J, Jain R. Overview of methicillin resistant Staphylococcus aureus mediated bone and joint infections in India. Orthop Rev. 2019;11(2):8070. [DOI:10.4081/or.2019.8070] [PMID] [PMCID]
34. Zhou W, Shan W, Ma X, Chang W, Zhou X, Lu H, et al. Molecular characterization of rifampicin-resistant Staphylococcus aureus isolates in a Chinese teaching hospital from Anhui, China. BMC Microbiol. 2012;12(1):240. [DOI:10.1186/1471-2180-12-240] [PMID] [PMCID]
35. Omar NN, Mohammed RK. A Molecular Study of Toxic Shock Syndrome Toxin gene (tsst-1) in β-lactam Resistant Staphylococcus aureus Clinical Isolates. Iraqi J Sci. 2021;6(3):825-37. [DOI:10.24996/ijs.2021.62.3.13]
36. Schluenzen F, Tocilj A, Zarivach R, Harms J, Gluehmann M, Janell D, et al. Structure of functionally activated small ribosomal subunit at 3.3 Å resolution. Cell. 2000;102(5):615-23. [DOI:10.1016/S0092-8674(00)00084-2] [PMID]
37. Ahmed ZA, Yousif AA. Molecular and phylogenetic analysis of methicillin resistant Staphylococcus aureus isolated from subclinical mastitis in lactating ewes. Iraqi J Vet Sci. 2021;35:121-6. [DOI:10.33899/ijvs.2021.131854.2013]
38. Rezashateri M, Ahrabi M, Salehi M. Molecular Analysis of the Presence of pvl, spa, and mecA Genes and Their Correlation with a Range of Antibiotics in Staphylococcus aureus Collected from Burn Patients. Iran J Med Microbiol. 2021;15(6):625-37. [DOI:10.30699/ijmm.15.6.625]
39. Guo Y, Song G, Sun M, Wang J, Wang Y. Prevalence and therapies of antibiotic-resistance in Staphylococcus aureus. Front Cell Infect Microbiol. 2020;10(107). [DOI:10.3389/fcimb.2020.00107] [PMID] [PMCID]
40. Lakhundi S, Zhang K. Methicillin-Resistant Staphylococcus aureus: Molecular Characterization, Evolution, and Epidemiology. Clin Microbiol Rev. 2018;31(4):e00020. [DOI:10.1128/CMR.00020-18] [PMID] [PMCID]
41. Ibraheem HT, Al-Mathkhury HJF. pvl-carried methicillin resistant Staphylococcus aureus isolated from hospitalized patients in Baghdad, Iraq. Iraqi J Sci. 2018;59(4):1967-72. [DOI:10.24996/ijs.2018.59.4B.1]
42. Lin T, Li Q, Jin D, Liu W, Tang C, Zhang X. Investigation of Virulence Genes of Staphylococcus aureus Isolated from Sterile Body Fluid Samples and Their Correlation with Clinical Symptoms and Outcomes. Can J Infect Dis Med Microbiol. 2021;2021:5354747. [DOI:10.1155/2021/5354747] [PMID] [PMCID]
43. Novick RP, Subedi A. The SaPIs: Mobile Pathogenicity Islands of Staphylococcus. 2007. In: Superantigens and Superallergens [Internet]. S.Karger AG. [DOI:10.1159/000100857] [PMID]
44. Al-Zamily KY, Al-Rubaey NKF, Al-Buhilal JAM. Molecular Detection of Some Virulence Genes in Stahpylococcus aureus Isolated from Different Human Clinical Specimens. Med Leg J. 2020;20(2):741-6.
45. Nguyen HTT, Nguyen TH, Otto M. The staphylococcal exopolysaccharide PIA - Biosynthesis and role in biofilm formation, colonization, and infection. Comput Struct Biotechnol J. 2020;18:3324-34. [DOI:10.1016/j.csbj.2020.10.027] [PMID] [PMCID]
46. Mahmoudi H, Pourhajibagher M, Chiniforush N, Soltanian AR, Alikhani MY, Bahador A. Biofilm formation and antibiotic resistance in meticillin-resistant and meticillin-sensitive Staphylococcus aureus isolated from burns. J Wound Care. 2019;28(2):66-73. [DOI:10.12968/jowc.2019.28.2.66] [PMID]
47. Habibi Najafi MB, Pezeshki P, editors. Bacterial Mutation; Types, Mechanisms And Mutant Detection Methods: A Review. 2013.
48. Yassin HY, Melconian AK, Mahmood SS. Prevalence of Exfoliative Toxin Genes among Clinical Isolates of Staphylococcus Aureus in Iraq. Iraqi J Agric Sci. 2022;53(2):465-70. [DOI:10.36103/ijas.v53i2.1554]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc