year 17, Issue 3 (May - June 2023)                   Iran J Med Microbiol 2023, 17(3): 346-353 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Abou Zeid M A, Samir A, Ezzat Hassan A. Rapid Molecular Technique for Detection of Food Borne Bacillus cereus Pathogen. Iran J Med Microbiol 2023; 17 (3) :346-353
URL: http://ijmm.ir/article-1-1931-en.html
1- Department of Bacteriology, Animal Health Research Institute, Agricultural Research Center (ARC), Kafr El-Sheikh Regional Laboratory, Kafr El-Sheikh, Egypt , Kindmemo@yahoo.com
2- Department of Biotechnology, Animal Health Research Institute, Agricultural Research Center (ARC), Reference Laboratory for Veterinary Quality Control on Poultry Production, Giza, Egypt
3- Department of Food Hygiene, Animal Health Research Institute, Agricultural Research Center (ARC), Giza, Egypt
Keywords: PCR, B. cereus, groEL, nhe, cytK
Full-Text [PDF 736 kb]   (719 Downloads)     |   Abstract (HTML)  (1984 Views)
Full-Text:   (490 Views)
Introduction


As a result of their high moisture content, plenty of nitrogenous compounds (amino acids, peptides, and proteins), and availability of minerals and auxiliary growth agents, meat and meat products are ideal for a variety of species to flourish. They also have a small amount of fermentable carbohydrates, usually in the form of glycogen, and they keep their pH at a level that encourages the growth of the majority of bacteria (1).
 A Gram-positive, rod-shaped endospore-forming bacterium called B. cereus is a major contributor to food-borne disease in people and is regularly engaged in food outbreaks (2).
It's possible for contamination or intoxication to cause B. cereus-related nutrition damage. Spores that develop in the small digestive tract and release diarrheal enterotoxins are contaminated when consumed (3).
 Bacillus cereus is a rod-shaped, Gram-positive, motile, facultatively anaerobic, aerobic, and spore-forming bacterium that is frequently encountered in the environment or as food contamination. The model organism of the Bacillus cereus genus, commonly known as B. cereus sensu lato, is Bacillus cereus sensu stricto (hereinafter B. cereus). This complex has up to ten heredities of species closely associated with hereditary and phenotypic (4).
 Despite being fairly salt-resistant and able to multiply at pH levels between 5 and 10, Bacillus cereus vegetative cells are rapidly destroyed by thermal treatments like pasteurization or frying (5). On the other hand, spores are extremely resilient to harsh circumstances, including tall temperatures, solidifying, drying, and gamma- and UV-irradiation, empowering B. cereus to outlive within the environment and on shifted surfaces.
 The B. cereus group contains a large number of phylogenetically similar species, like B. cereus, B. anthracis, B. thuringiensis, B. cytotoxicus, and others.B. toyonensis, B. mycoides, and B. pseudomycoides (6).
The B. cereus manufactures enterotoxins because hemolysin BL (Hbl), nonhemolytic enterotoxin (Nhe) complex, and cytotoxin K (cytK) proteins are thought to be the main enterotoxin causes in B. cereus diarrhea (7). Also, the emetic toxin can be formed by B. cereus (8). The molecular methods can predict the existence or absence of the target enterotoxin gene. The analysts predicted that the utilization of atomic strategies permits the discovery of B. cereus food poisoning gene targets than strain assurance (9). The work aimed to replace routine culture testing, used to investigate food products that may have been contaminated with Bacillus cereus, by using PCR to directly detect the bacteria and some of its enterotoxins from food.


 

Materials and Methods

2-1- Collection of samples

A total of 75 random samples of Kibda sandwiches, Sausage sandwiches, Chicken Luncheon, Beef luncheon meat, and Chicken Shawarma (Fifteen samples of each) ) were collected from distinctive places in numerous regions in Kafr El-Sheikh governorate, Egypt. The samples were put in isolated, sterile packs and exchanged straightforwardly to the laboratory for assisted bacteriological examination.

2-2- Preparation of samples

Based on  (10), the samples were prepared for bacteriological examination. Specifically, one portion of the food samples was primarily cultivated on Trypticase Soy Broth (TSB) at 37˚C for 24 hours, after which the broth samples were subjected to traditional isolation, identification of bacteria by biochemical test, and PCR, which was represented by group A. The other portion of the food samples was processed for extracting DNA from samples directly for rapid detection of Bacillus cereus & its enterotoxins (group B which represents samples taken from food related to positive isolates, and group C taken randomly from food of negative isolation results).

2-3- Bacteriological examinations:

Isolation of Bacillus cereus

Trypticase Soy Broth (TSB) tubes were filled with the necessary quantity of each prepared sample and subsequently incubated for 48 ± 2 h at 30 ± 2 ◦C. then, a loop of the produced cultures was streaked on mannitol egg yolk polymyxin agar plates (MYP), which were incubated 48 ± 2 h at 30 ± 2 ◦C. Pink colonies encircled by a zone of precipitation and suspected to be lecithinase-positive colonies were chosen for morphological and biochemical identification.

Identification of bacterial isolates

The separated microscopic organisms were recognized as infinitesimally and biochemically concurring (11). The distinguished B. cereus strains were motile Gram-positive large rods with non-swelling spores, lecithinase positive and on MYP agar, β-hemolytic on blood agar. Biochemically, all isolates passed the Voges-Proskauer, nitrate reduction, catalase, citrate utilization, and glucose fermentation assays. They failed the tests for methyl red, indole, mannitol fermentation, H2S generation, and oxidase. Detection of groEL targeted primer for detection of B. cereus & some enterotoxins genes using Polymerase Chain Reaction (PCR).

Extraction of DNA.

The QIAamp DNA Smaller than expected unit (Qiagen, Germany, GmbH) was utilized to extricate DNA from tests, with a few alterations made to the manufacturer's information. In a nutshell, 200 µL of the test suspension was treated at 56 OC for 10 min with 10 µL of proteinase K and 200 µL of lysis arrangement. 200 µL of 100% ethanol was included in the lysate after brooding. After that, the test was cleaned and centrifuged after the manufacturer's enlightening. The kit's 100 µL of elution buffer was utilized to elute the nucleic corrosive.

Oligonucleotide Primer

The preliminaries utilized were provided from Metabion (Germany) and are recorded within the table (1).

PCR amplification

PCR A 25 µL response containing 12.5 µL of EmeraldAmp Max PCR Ace Blend (Takara, Japan), 1 µL of each preliminary at a concentration of 20 pmol, 5.5 µL of water, and 5 µL of DNA format was utilized to test the preliminaries. Warm cycle 2720 from Connected Biosystems was utilized to carry out the method.

Analysis of the PCR Products.

The PCR items were isolated utilizing 5V/cm angle electrophoresis on a 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature. Each gel space had 20 µL of the products embedded for the gel examination. The sizes of the parts were decided to employ a 100 bp Generuler step from Fermentas in Germany. A gel documentation framework (Alpha Innotech, Biometra) took pictures of the gel, and the computer program was utilized to analyze the information. Details of the groundworks utilized were recorded in (Table 1).
 

Table 1. Primers sequences, target genes, amplicon sizes and cycling conditions.

Target gene
B. cereus
Primers sequences Amplified segment (bp) Primary
denaturation
Amplification (35 cycles) Final extension Reference
Secondary denaturation Annealing Extension
groEL TGCAACTGTATTAGCACAAGC T 533 94˚C
5 min.
94˚C
30 sec.
55˚C
40 sec.
72˚C
45 sec.
72˚C
10 min.
(12)
TACCACGAAGTTTGTTCACTACT
nhe AAG CIG CTC TTC GIA TTC 766 94˚C
5 min.
94˚C
30 sec.
49˚C
40 sec.
72˚C
45 sec.
72˚C
10 min.
(13)
ITI GTT GAA ATA AGC TGT GG
cytK ACA GAT ATC GGI CAA AAT GC 421 94˚C
5 min.
94˚C
30 sec.
49˚C
40 sec.
72˚C
45 sec.
72˚C
10 min.
CAA GTI ACT TGA CCI GTT GC


 

Results

3-1- Incidence of Bacillus cereus.


Table 2. Incidence of Bacillus cereus isolated from examining Kibda sandwiches, Sausage sandwiches, Chicken luncheon, Meat luncheon and Chicken shawerma sandwiches.

Types of Samples No. of samples No. of positive samples Percentage %
Kibda sandwiches 15 6 40
Sausage sandwiches 15 4 26.6
Chicken luncheon 15 3 20
meat Luncheon 15 2 13.3
Chicken shawerma sandwiches 15 2 13.3
Total 75 17 22.6

Molecular characterization of groEL gene of Bacillus cereus group & some enterotoxins genes (nhe & cytK) of Bacillus cereus.
 

Twenty two samples divided into three groups (group A represents 8isolates, group B represents 8samples taken directly from food related to isolates and group C representative 6samples taken directly from food of negative isolation results) subjected to molecular characterization of groEL gene of Bacillus cereus & enterotoxins genes (nhe & cytK). Our results cleared that all isolates of group A & samples taken directly from food related to isolates (group B) carried groEL gene by 100%, group C carried groEL gene by 50%, while the enterotoxins genes nhe& cytK were presented by 75% & 25% in group A & group B respectively, but in the group C were represented by 50% for each (Table 3) (Figure 1 and 2).

 
Table 3. Prevalence of groEL gene for detection of Bacillus cereus in the three groups and some of its enterotoxins genes (nhe &cytK)

GP Sample groEL nhe cytK
 
A (isolates) A1 + + -
A2 + + -
A3 + + -
A4 + + -
A5 + + -
A6 + + -
A7 + - +
A8 + - +
Total (%) 8 (100%) 6 (75%) 2 (25%)
B (Food related to isolates) B1 + + -
B2 + + -
B3 + + -
B4 + + -
B5 + + -
B6 + + -
B7 + - +
B8 + - +
Total (%) 8 (100%) 6 (75%) 2 (25%)
C (Food of negative isolation result) C1 - ND ND
C2 + + +
C3 - ND ND
C4 + + +
C5 - ND ND
C6 + + +
Total (%) 3 (50%) 3 (50%) 3 (50%)

 
Figure 1. Agarose gel electrophoresis of PCR amplification products of groEL and nhe enterotoxin genes

Figure 1. Agarose gel electrophoresis of PCR amplification products of groEL and nhe enterotoxin genes

  1.  Amplification of 533 bp of  groEL gene among group A.  Lane L: 100-1000 bp DNA molecular size marker  , Lane P: Control positive  Bacillus cereus groEL gene 533bp   , and Lanes 1, 2, 3, 4, 5, 6, 7 and 8: Positive Bacillus cereus isolates.

  2. Amplification of 533 bp of  groEL gene among group B. Lane L:100-1000 bp DNA molecular size marker , Lane P: Control positive Bacillus cereus groEL gene  533bp, and Lanes 1, 2, 3, 4, 5, 6, 7and 8: Positive  Bacillus cereus samples for groEL gene.

  3. Amplification of 533 bp of  groEL gene amonggroup C. Lane L:100-1000 bp DNA molecular size marker, Lane : Control positive  Bacillus cereus groEL gene  533bp, and Lanes 2, 4 and 6: Positive  Bacillus cereus samples for groEL gene)

  4. Amplification of 766 bp products of nhe enterotoxin gene among group A. Lane L:100-1000 bp DNA molecular size marker, Lane P: Control positive  Bacillus cereus nhe enterotoxin gene at 766bpand Lanes 1, 2, 3, 4, 5 and 6: Positive  Bacillus cereus isolates for nhe gene.

  5. Amplification 766 bp products of nhe enterotoxin gene among group B. Lane L: 100-1000 bp DNA molecular size marker, Lane P: Control positive Bacillus cereus nhe enterotoxin gene at 766bp and Lanes 1, 2, 3, 4, 5and 6: Positive Bacillus cereus samples for nhe gene.

  6. Amplification products of 766 bp nhe enterotoxin gene among group C. Lane L:100-1000 bp DNA molecular size marker, Lane P: Control positive  Bacillus cereus nhe enterotoxin gene at 766 bp and Lanes 2, 4and 6: Positive  Bacillus cereus samples for nhe gene.

 
Figure 2. Agarose gel electrophoresis of PCR amplification products of cytK enterotoxin gene 
Figure 2. Agarose gel electrophoresis of PCR amplification products of cytK enterotoxin gene

  1. Amplification of 421 bp products of cytK enterotoxin gene among group A. Lane L:100-1000 bp DNA molecular size marker , Lane P: Control positive  Bacillus cereus cytK enterotoxin gene at 421 bp and Lanes 7 and 8: Positive Bacillus cereus isolates for cytK gene.

  2. Amplification of 421bp products of cytK enterotoxin gene among group B for  Bacillus cereus. Lane L:100-1000 bp DNA  molecular size marker, Lane P: Control positive  Bacillus cereus cytK enterotoxin gene at 421bp and Lanes 7 and 8: Positive  Bacillus cereus samples for cytK gene.

  3. Amplification of 421 bp products of cytK enterotoxin gene among group C. Lane L:100-1000 bp DNA molecular size marker, Lane P: Control positive  Bacillus cereus cytK enterotoxin gene at 421bp and Lanes  2,4 and 6: Positive  Bacillus cereus samples for cytK gene.

 
 

Discussion

In recent decades, Bacillus cereus has become a significant foodborne pathogen, producing two separate illnesses by developing one emetic toxin and three other enterotoxins (14).
The results revealed that B. cereus was detected in 17 positive examined food samples [Kibda sandwiches, Sausage sandwiches, Chicken luncheon, Meat luncheon and chicken shawarma sandwiches) showed an incidence of 22.6%. These findings were lower than those mentioned by Yu et al. (15) isolated B. cereus with a percentage of 35% from the tested retail ready-to-eat food samples from different regions of China. The results were nearly similar to those of Tewari et al. (16). isolated 29 B. cereus isolates from  94 raw meat and meat product samples (30.9%), but our results were higher than Mostafa et al. (17), who observed B. cereus strains in 11.1% of meat products (chicken luncheon, beef luncheon, kofta, minced meat, beef burger and sausage).
The data revealed that from the 17 positive food samples, 40 % were positive for Bacillus cereus isolated from Kibda sandwiches, 26.6% were positive for Bacillus cereus isolated from Sausage sandwiches, 20% were positive for Bacillus cereus isolated from Chicken luncheon, 13.3% were positive for Bacillus cereus isolated from both Meat luncheon and Chicken shawarma sandwiches. These results are nearly similar to those mentioned by Mousa et al. (18) isolated Bacillus cereus with a percentage of 17.1% from luncheon samples and 25.7% from Sausage, and Samir et al. (19), recorded 20% incidences in luncheon samples, El Rahman et al. (20), reported B. cereus was 16% in shawarma sandwiches, and Mostafa et al. (17), isolated it in sausage by 23.7% & in beef luncheon by 10.5%, our findings were lower than those mentioned by Abostate et al. (21), who detailed that the frequency of Bacillus cereus in Meat luncheons and Chicken luncheons was 60% & 53.3%, respectively, and El- Sayed, (22), who isolated it from the fried liver (kibda) and Shawarma in a percentage of 88.57 and 97.14, respectively. Also, Ahmed et al. (23), found an incidence of 26.7%, and 46.7% in Luncheon and Sausage. Finally, the recorded results were higher than those reported by Meshref, (24), who mentioned that the incidence of Bacillus cereus in the examined samples of Shawarma and Kibda sandwiches was 4% for both. Researchers' varied findings may be a result of regional, seasonal, sample, and methodological variations. Additionally, the level of contamination is influenced by the processing safety measures used. Bacillus cereus is to blame for numerous outbreaks of food borne illnesses since it contains enterotoxins and emetic toxins. Two different food-borne disorders may be brought on by several toxins, according to the descriptions. The diarrheal form of the disease has been associated with hbl, nhe, and a variant of the single cytotoxin K (25). According to several studies, many bacterial infections can contaminate ready-to-eat meals through food preparation surfaces (26, 27) Antibiotics cannot enter bacteria’s cells because of proteins in their S-layer, which dramatically increases the pathogenicity of the bacterium (28).
B. cereus is responsible for a small percentage of food-borne diseases (2–5%), which result in severe nausea, vomiting, and diarrhea. When food is cooked incorrectly, the bacterial endospores survive, which leads to bacillus foodborne diseases. Some B. cereus spores may withstand cooking at temperatures lower than or equal to 100 °C (212 °F) (29).
There are two sorts of B cereus nourishment harming: the diarrheal frame, which is brought on by expending a part of bacterial cells or their spores in sullied nourishment, and the emetic form, which is brought on by consuming food contaminated with the toxin already created. Abdominal pain and diarrhea are the main symptoms of the diarrheal kind after an 8 to 16-hour incubation period (30). The toxin (cereulide) that frequently causes the emetic shape is warm steady and causes queasiness and spewing 1–5 hours after consumption  (31).
B. cereus isolates were characterized using gene profiling techniques that targeted the genes Nhe, Hbl, cytK, and ces (13, 32, 33), According to PCR assays, the groEL gene for detection of Bacillus cereus and different virulence genes (nheA and cytK) of 22 different samples divided into three groups (group A represent isolates, group B represent samples taken directly from food related to isolates and group C represent samples taken directly from food of negative isolation results). Our results showed that all strains of group A & group B carried groEL gene by 100%, while group C carry the groEL gene by 50%, while the enterotoxins genes nhe & cytK were presented by 75% & 25% in group A & group B but in the group, C is represented by 50% for each. Nearly similar results were recorded by Berthold-Pluta et al. (34), who showed that the event of toxigenic B. cereus strains in all tried advertise items, of plant beginning were 70.7% for nhe and 82.7% for nhe in creature origin, and Hwang and Park, (35), who found 20 %  of isolates from Infant formulas harboring cytK gene, higher results were recorded by Yu et al. (15), who tried retail ready-to-eat nourishment tests from diverse districts of China and found 83% of the disconnected strains harboring the enterotoxin-encoding nheABC quality clusters, The cytK quality was display in 68% of isolates (15). Tewari et al. (16), found toxin gene nhe by 89.7%, Rather et al., (36) detected the incidences of various enterotoxigenic genes of Bacillus cereus in meat and meat products were 96.61%, 96.61%, 93.22% and 67.78% for nheA, nheB, nheC and cytK respectively, El- Sayed, (22), recorded nhe and cytk genes in all examined samples. Also, In our research, the most predominant gene was nheA, followed by cytK in accordance with Mostafa et al. (17). In our study, we found that the detection of B. cereus directly from food by PCR methodology has resulted in a rapid and sensitive test in the detection of B. cereus and some of its enterotoxins. Here, PCR tests enable the identification of negative isolation samples, which cuts down on time-consuming manual testing. Our findings demonstrated that B. cereus is present in various foods and that the isolated strains have a variety of pathogenic genes that could potentially raise the risk of food borne illnesses.

 
 

Conclusion

Using the PCR strategy directly from food would allow for more efficient and rapid testing in the detection of Bacillus cereus& its enterotoxins, which should help understand the potential toxigenicity of B. cereus in food. Finally, it can be concluded that it is important to take strict hygienic measures in handling and preparation to avoid contamination with Bacillus cereus and its toxins. Also, proper temperature cooking destroys the vegetative cells of B. cereus.
 
 

Acknowledgment

'Not applicable.’

 

Funding

'Not applicable.’

 

Author Contributions

 Mayada A.M. Abou Zeid found a research idea, planned the study design, performed the bacteriological and molecular examinations, and drafted the manuscript. AbdElhafez Samir and Asmaa Ezzat Hassan shared the molecular examinations, shared designed work, and shared a collection of samples and helped the manuscript preparation. All authors approved the final manuscript.

 

Conflicts of Interest

Regarding this paper's research, writing, and/or publication, the authors declare that they have no potential conflicts of interest.
 

Type of Study: Original Research Article | Subject: Food Microbiology
Received: 2023/01/20 | Accepted: 2023/04/25 | ePublished: 2023/06/26

References
1. Vega-Gálvez A, Miranda M, Vergara J, Uribe E, Puente L, Martínez EA. Nutrition facts and functional potential of quinoa (Chenopodium quinoa willd.), an ancient Andean grain: a review. J Sci Food Agric. 2010;90(15):2541-7. [DOI:10.1002/jsfa.4158] [PMID]
2. Hall JA, Goulding JS, Bean NH, Tauxe RV, Hedberg CW. Epidemiologic profiling: evaluating foodborne outbreaks for which no pathogen was isolated by routine laboratory testing: United States, 1982-9. Epidemiol Infect. 2001;127(3):381-7. [DOI:10.1017/S0950268801006161] [PMID] [PMCID]
3. Riemann H. Food borne Infections and Intoxications, Elsevier, San Diego Ca,Osfayo-Barbe Km, Schrenzelj, Freyj, Studer R, Korffc, Bellidc, Parvexpp, Rimensbergerpc, Schappi Mg. Food poisoning is a cause of acute liver failure. Pediatr Infect Dis J. 2006(27):846-7. [DOI:10.1097/INF.0b013e318170f2ae] [PMID]
4. Carroll LM, Wiedmann M, Kovac J. Proposal of a Taxonomic Nomenclature for the Bacillus cereus Group Which Reconciles Genomic Definitions of Bacterial Species with Clinical and Industrial Phenotypes. MBio. 2020;11(1):10-128. [DOI:10.1128/mBio.00034-20] [PMID] [PMCID]
5. Food Standard Australia New Zealand (FSANZ). Bacillus cereus. 2013.
6. Carroll LM, Cheng RA, Wiedmann M, Kovac J. Keeping up with the Bacillus cereus group: taxonomy through the genomics era and beyond. Crit Rev Food Sci Nutr. 2022;62(28):7677-702. [DOI:10.1080/10408398.2021.1916735] [PMID]
7. Lund T, De Buyser ML, Granum PE. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol. 2000;38(2):254-61. [DOI:10.1046/j.1365-2958.2000.02147.x] [PMID]
8. Agata N, Ohta M, Arakawa Y, Mori M. The bceT gene of Bacillus cereus encodes an enterotoxic protein. Microbiol. 1995;141(4):983-8. [DOI:10.1099/13500872-141-4-983] [PMID]
9. Ehling-Schulz M, Messelhäusser U. Bacillus "next generation" diagnostics: moving from detection toward subtyping and risk-related strain profiling. Front Microbiol. 2013;4:32. [DOI:10.3389/fmicb.2013.00032] [PMID] [PMCID]
10. APHA "American Public Health Association". Compendium of Methods for the Microbiological examination of Foods. Washington, D.C USA; 2001.
11. Procop G, Church D, Hall G, Janda W, Koneman E, Schreckenberger P, et al. Aerobic and facultative Gram-positive bacilli‖. In Koneman's Color Atlas and Textbook of Diagnostic Microbiology. USA: Lippincott Williams and Wilkins Company, Philadelphia; 2017.
12. Das S, Lalitha K, Thampuran N. Isolation and molecular characterization of atypical enterotoxigenic Bacillus cereus with negative Voges-Proskauer reaction from Indian White Shrimp Fenneropenaeus indicus Indian J Fish. 2013;60(4):113-7.
13. Ehling-Schulz M, Guinebretière M. AMonthan; O Berge; M Fricker; B Svensson. FEMS Microbiol Let. 2006;260(2):232-40. [DOI:10.1111/j.1574-6968.2006.00320.x] [PMID]
14. Granum PE, Lund T. Bacillus cereus and its food poisoning toxins. FEMS Microbiol Lett. 1997;157(2):223-8. [DOI:10.1111/j.1574-6968.1997.tb12776.x] [PMID]
15. Yu S, Yu P, Wang J, Li C, Guo H, Liu C, et al. A Study on Prevalence and Characterization of Bacillus cereus in Ready-to-Eat Foods in China. Front Microbiol. 2020;10:3043. [DOI:10.3389/fmicb.2019.03043] [PMID] [PMCID]
16. Tewari A, Singh SP, Singh R. Incidence and enterotoxigenic profile of Bacillus cereus in meat and meat products of Uttarakhand, India. J Food Sci Technol. 2015;52:1796-801. [DOI:10.1007/s13197-013-1162-0] [PMID] [PMCID]
17. Mostafa NF, Elkenany RM, Younis G. Characterization of Bacillus cereus isolated from contaminated foods with sequencing of virulence genes in Egypt. Braz J Biol. 2022;84:e257516. [DOI:10.1590/1519-6984.257516] [PMID]
18. Mousa D, Abd El Tawab A, El Hofy F, Maarouf A. Molecular studies on antibiotic resistant Bacillus cereus isolated from meat products and human in Kaliobia, Egypt. Benha Vet Med J. 2020;38(2):125-30. [DOI:10.21608/bvmj.2020.25802.1187]
19. Samir MM, Hanan MTE, Wafa FA, editors. Incidence of Bacillus cereus in some raw and cooked meat products and its control by heat treatment2012 2012: Massive Conferences and Trade Fairs.
20. El Rahman SSA, Samaha IA, Haggag YN, Nossair MA. Incidence of Some Pathogenic Bacteria in Fast Food Sandwiches. Alex J Vet Sci. 2018;59(2):103-8. [DOI:10.5455/ajvs.293290]
21. Abostate MAM, Zahran DA, El-Hifnawi HN. Incidence of Bacillus cereus in some meat products and the effect of gamma radiation on its toxin (s). Int J Agric Biol. 2006;8:1-4.
22. El-Sayed AA. Probable dangers from take away meat products meals: PhD thesis. Food Control Dep, Fac Vet Med, Zagazig University; 2015.
23. Ahmed F, Hassan MA, Amin R, Eleiwa N. Incidence and Characterization of Bacillus Cereus in Some Meat Products Using PCR. Benha Vet Med J. 2019;37(1):86-90. [DOI:10.21608/bvmj.2019.18074.1114]
24. Meshref AH. Incidence of some pathogenic bacteria in fast foods: Thesis, Master of Veterinary Medicine, Alexandria University, Egypt; 2018.
25. Stenfors Arnesen LP, Fagerlund A, Granum PE. From soil to gut: Bacillus cereus and its food poisoning tox. FEMS Microbiol Rev. 2008;32(4):579-606. [DOI:10.1111/j.1574-6976.2008.00112.x] [PMID]
26. Christison CA, Lindsay D, Holy A. Microbiological survey of ready-to-eat foods and associated preparation surfaces in retail delicatessens, Johannesburg, South Africa. Food Control. 2008;19:727-33. [DOI:10.1016/j.foodcont.2007.07.004]
27. Cho JI, Lee SH, Lim JS, Koh YJ, Kwak HS, Hwang IG. Detection and distribution of food-borne bacteria in ready-to-eat foods in Korea. Food Sci Biotechnol. 2011;20(2):525-9. https://doi.org/10.1007/s10068-010-0073-3 [DOI:10.1007/s10068-011-0073-y]
28. Jalalpoor S, Kermanshahi R, Noohi A, Zarkesh Esfahani H. Role of surface layer nanostructure and production of β-lactamase in penicillin resistant Bacillus cereus strains. Iran J Med Microbiol. 2010;4(1):42-8.
29. Kotiranta A, Lounatmaa K, Haapasalo M. Epidemiology and pathogenesis of Bacillus cereus infections. Microbes Infect. 2000;2(2):189-98. [DOI:10.1016/S1286-4579(00)00269-0] [PMID]
30. Murray P, Baron E, Jorgensen J, Landry M, Pfaller M. Manual of clinical microbiology. 9 ed. Washington D.C. USA: American Society of Microbiology Press; 2007.
31. Hoton FM, Andrup L, Swiecicka I, Mahillon J. The cereulide genetic determinants of emetic Bacillus cereus are plasmid-borne. Microbiol. 2005;151(7):2121-4. [DOI:10.1099/mic.0.28069-0] [PMID]
32. Fricker M, Messelhäußer U, Busch U, Scherer S, Ehling-Schulz M. Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl Environ Microbiol. 2007;73(6):1892-8. [DOI:10.1128/AEM.02219-06] [PMID] [PMCID]
33. Tallent SM, Hait JM, Bennett RW. Analysis of Bacillus cereus toxicity using PCR, ELISA and a lateral flow device J Appl Microbiol. 2015;118(4):1068-75. [DOI:10.1111/jam.12766] [PMID]
34. Berthold-Pluta A, Pluta A, Garbowska M, Stefańska I. Prevalence and Toxicity Characterization of Bacillus cereus in Food Products from Poland. Foods. 2019;8(7):269. [DOI:10.3390/foods8070269] [PMID] [PMCID]
35. Hwang JY, Park JH. Characteristics of enterotoxin distribution, hemolysis, lecithinase, and starch hydrolysis of Bacillus cereus isolated from infant formulas and ready-to-eat foods. J Dairy Sci. 2015;98(3):1652-60. [DOI:10.3168/jds.2014-9042] [PMID]
36. Rather MA, Aulakh RS, Gill JPS, Rao TS, Hassan MN. Direct Detection of Bacillus cereus and its Enterotoxigenic Genes in Meat and Meat Products by Polymerase Chain Reaction. J Adv Vet Res. 2011;1(3):99-104.

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2025 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc