year 16, Issue 6 (November - December 2022)                   Iran J Med Microbiol 2022, 16(6): 573-580 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kashkouri N, Tabarsi P, Pourabdollah Toutkaboni M, Kazempour Dizaji M, Bahrami N, Narimani A, et al . The Prevalence of Carbapenemase Genes in Carbapenem-resistant Gram-negative Bacilli, Masih Daneshvari Hospital, Tehran, Iran, 2019-2020. Iran J Med Microbiol 2022; 16 (6) :573-580
URL: http://ijmm.ir/article-1-1814-en.html
1- Chronic Respiratory Diseases Research Center, National Research Institute of Tuberculosis and Lung Diseases (NRITLD), Shahid Beheshti University of Medical Sciences, Tehran, Iran
2- Clinical Tuberculosis and Epidemiology Research Center, National Research Institute of Tuberculosis and Lung Diseases (NRITLD), Shahid Beheshti University of Medical Sciences, Tehran, Iran
3- Biostatistics Department, Mycobacteriology Research Center, National Research Institute of Tuberculosis and lung Diseases, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4- Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, Iran
5- Department of Cell and Molecular Biology, School of Biological Sciences, North Tehran Branch, Islamic Azad University, Tehran, Iran
6- Chronic Respiratory Diseases Research Center, National Research Institute of Tuberculosis and Lung Diseases (NRITLD), Shahid Beheshti University of Medical Sciences, Tehran, Iran , mohamadnia.ar@gmail.com
Full-Text [PDF 626 kb]   (1303 Downloads)     |   Abstract (HTML)  (3836 Views)
Full-Text:   (1257 Views)
Introduction


The Enterobacteriaceae family is the most heterogeneous group of clinically significant Gram-negative bacilli that are widely distributed in nature and can cause serious infections that lead to Nosocomial infection, also known as hospital infection or hospital-acquired infection (HAI), cystitis, pyelonephritis, pneumonia, meningitis, and more (1, 2). These bacteria are rod-shaped, nonspore-forming and are among the most important opportunistic pathogens, including many pathogens such as Klebsiella, Enterobacter, Citrobacter, Salmonella, Escherichia coli, Shigella, Proteus, Serratia and other species (3).
Pseudomonas is one of the genera of bacteria in this group. These Gram-negative bacteria are motile, aerobic, abundant in water and soil, and inhabit plants and animals (4). Pseudomonas sp. is present as normal flora on humans' skin, nostrils, and upper respiratory tract. It is also found in the intestines of more than 40% of healthy people. This percentage increases in hospitalized patients relative to the average length of hospital stay (5). The most important species of this genus is Pseudomonas aeruginosa, which can cause infections in the blood, lungs (pneumonia), or other body parts after surgery in patients with autoimmune disease (6). This bacterium is the third leading cause of nosocomial infections after Staphylococcus aureus and Escherichia coli, and it is in the "critical group" list of the WHO (7). P. aeruginosa has native resistance to penicillin and most beta-lactam antibiotics (8). Acinetobacter baumannii, another Gram-negative bacterium, is an opportunistic pathogen that mainly causes nosocomial infections, particularly in patients admitted to the intensive care unit (ICU) (9). This bacterium contributes to infections such as UTI, pneumonia, and sepsis during and after hospitalization (10). Recent reports have indicated resistance to carbapenems and cephalosporins among Enterobacteriaceae (11, 12).
Resistance mechanisms to antimicrobial agents can be intrinsic and acquired. The latter mechanisms result from mutational events (espe­cially for quinolone resistance) or, more often, the acquisition of various mobile genetic elements such as transposons and plasmids. First reported in the early 1980s in Germany and France, a major problem in the medical field in recent times is the increasing number of Enterobacteriaceae strains found to produce extended-spectrum β-lactamases (ESBLs) (13, 14).
Beta-lactams, especially broad-spectrum cephalosporins and fluoroquinolones, are the first-line treatment for infections caused by Gram-negative bacteria (15, 16). However, one of the major challenges associated with treating these bacterial infections is the Emergence of multi-drug resistant (MDR) isolates, which can be possibly due to the widespread and uncontrolled use of antimicrobial agents, especially in developing countries (16). Developed in the 1980s, carbapenems (the most widely used is imipenem, followed by meropenem and ertapenem) are derivatives of thienamycin and have broad-spectrum activities and are used to treat infections caused by ESBL-producing strains.
Among beta-lactamase enzymes, Carbapenemases and Metallo-beta-lactamases are the most important, causing major problems in treating infectious diseases due to their effect on a wide range of antibiotics such as penicillin, broad-spectrum cephalosporins, and carbapenems (17-19). Therefore, it is crucial to study the presence and frequency of these enzymes in clinical isolates to control the spread of antibiotic-resistant bacteria and detect infections caused by these pathogens at an early stage.
The present study aimed to identify carbapenemase-producing strains of Gram-negative isolated bacteria and determine their antibiotic susceptibility pattern in samples obtained from the Masih Daneshvari hospital, Tehran, Iran.


 

Materials and Methods

Sample Collection

This cross-sectional study was conducted from March 2021 to March 2022 in Masih Daneshvari Hospital, Iran. 1600 samples were collected randomly from the Clinical Laboratory of Masih Daneshvari hospital, Tehran, Iran, from various clinical specimens, including urine, respiratory tract, abdominal fluid, and blood. For this purpose, all incoming samples were checked, suspicious or weak samples were excluded from the study, and the samples confirmed in the bacteriology department were included. These samples were then examined for isolation of Gram-negative bacteria. To identify these bacteria, samples were cultured on MacConkey agar. Gram-negative bacilli were then inoculated into different media, including Simmons Citrate agar, Kligler's Iron agar, Methyl Red / Voges-Proskauer and Triple Sugar Iron agar (Neogen, Italy). After 24 hours of incubation at 37°C, the colonies were isolated. Subsequently, oxidase and urease tests were performed for the isolated bacteria.

Antibiotic Susceptibility Test

Antibiotic susceptibility test for bacterial strains was determined by the Kirby-Bauer disk diffusion method on Mueller-Hinton agar, according to the recommendation of the Clinical and Laboratory Standards Institute (CLSI, 2020), using imipenem (10 μg/mL) and meropenem (10 μg/mL).
For this purpose, we initially prepared a Mueller-Hinton agar and a bacterial suspension with turbidity equivalent to 0.5 McFarland. Then, the suspension was cultured on the Mueller-Hinton agar by swabbing a sterile swab in three different directions. After 15 minutes of complete application of the microbial suspension on the medium, the antibiotic discs were placed 2 cm apart. Finally, after 24 hours of incubation at 37 °C, the diameter of the grown halos was measured by a ruler and assessed based on the CLSI instructions (13).
Quality control strains of Escherichia coli ATCC®* 25922 and Pseudomonas aeruginosa ATCC® 27853 (for carbapenems) were used to validate the results of the antimicrobial discs.

Evolution of Carbapenemase-encoding Genes

Also, the real-time polymerase chain reaction (Real-time PCR) method was used for the molecular evaluation of carbapenemase-encoding genes. For this purpose, 250 samples were randomly selected. Then, several bacteria colonies were cultured in 10 mL of Tryptic Soy Broth (TSB) medium. After 24 hours of incubation at 37-35 °C, DNA extraction was performed using a DNA extraction kit (Yekta-tajhiz Co., Iran). Real-time PCR in 2 biological replicates was performed using a real-time PCR system (Applied Biosystems StepOne instrument), SYBR Green Master Mix and sets of primers (Table 1). The StepOne software (Applied Biosystems; version 2.1) was used to analyze the results (19-25).


Table 1. Primer sequences used for gene expression analysis by quantitative PCR (26)

Genes Sequence (5' à 3') Annealing temperature Amplicon length (bp)
oxa -48 F: TGGTGGCATCGATTATCG
R: AGCACTTCTTTTGTGATG
58˚C 743
kpc F: TCGAACAGGACTTTGGC
R: GAACCAGCGCATTTTTG
57˚C 489
ndm F: CCGCCTGGACCGATGACC
R: CCAAAGTTGGGCGCGGT
60˚C 263
imp F: AGGCGTTTATGTTCATAC
R: GTAAGTTTCAAGAGTGAT
53˚C 585
vim F: TTGGTCGCATATCGCAAC
R: AATGCGCAGCACCAGGAT
58˚C 261
ges F: GCGCTTCATTCACGCAC
R: CTATTTGTCCGTGCTCAG
57˚C 640
β-globulin (housekeeping) F: AGAGTTTGATCCTGGCTCAG
R: GGTTACCTTGTTACGACTT
55˚C 120

Carrying out the Real-time RT-PCR test by HotTaq EvaGreen qPCR Mix:
SYBR Green is a fluorescence color that has been used in the kit produced by Cynacolon Company (Cat No.BT11101, Iran). The components needed for reaction have been provided in mastermix of the kit. The components of Real-time PCR reaction included the following cases: Extracted DNA 2 μL (50 ng/μL), Master mix at 4 μL, Primer forward and reverse 10 pmol, Deionized distilled water to an extent in which the final reaction volume reaches 20 μL
The temperatures and reaction program was adjusted according to the kit's instructions (Table 2).

Statistical Analysis

Susceptibility data were compared by using a Chi-square test with SPSS (SPSS Inc., Chicago, Ill. USA) version 20 software. We calculated susceptibility and resistance as percentages based on a 95% confidence interval. Based on the categories of the selected variable, cross-tabulations of the presence of resistant/intermediate/susceptible isolates were performed. Statistical significance was defined as a P value of 0.05.

 
Table 2. Real-time RT-PCR reaction temperatures and times

Real-time step Temperature Duration
Initial activation 95ºC 10 min
40 cycles
Denaturation 59ºC 15 Sec
Annealing 56-60ºC 60 Sec
Extension 72ºC 20 Sec

 
 

Results

Among 1600 samples, 1502 (93.87%) belong to Enterobacteriaceae. 1005 (62.8%) pertained to samples collected from male patients and 37.2% samples from women. There was no significant difference between the gender of and contamination with Enterobacteriaceae (P>0.05). The frequency of isolates from various clinical specimens was as follows: tracheal tube (44%), bronchus (28%), sputum (23%), and urine (5%). Also, with regards to the age of the study population, 9.3% were under 30 years, 30.9% were 31 to 50 years old, 41.8% were 51 to 70 years old, and 18% were older than 70 years. Furthermore, 38.7% of the samples were obtained from the ICU, 29.3% from the emergency department, 22.5% from the internal medicine ward, 4.9% from the laboratory, 3.5% from the bronchoscopy unit, and 1.1% from the infectious department.
While the most frequently isolated bacteria was Pseudomonas aeruginosa (37.3%), the lowest frequency was for Enterococci (0.4%). The frequency of bacterial strain isolates is shown in Figure 1.
 
 Figure1. The frequency of isolates in terms of bacterial strain
Figure1. The frequency of isolates in terms of bacterial strain
 
In this study, we determined antibiotic susceptibility to the carbapenems family, including imipenem and meropenem, for Gram-negative bacteria. Of a total of 1502 Gram-negative bacilli, 1105 (73.5%) isolates were carbapenem-sensitive, while the remaining 397 (26.5%) isolates were carbapenem-resistant. The results are shown in Figure 2. 29.80% of Pseudomonas aeruginosa was resistant to the carbapenems family.
200 (80%) of 250 tested isolates had resistance genes to at least one antibiotic resistance gene. The following carbapenemase genes were most frequently detected among carbapenem-resistant strains: imp (70 isolates; 35%), vim (40 isolates; 20%), kpc (30 isolates; 15%), oxa -48 (20 isolates; 10%), ndm (20 isolates; 10%), and GES (20 isolate; 10%).

 

Figure 2. The frequency of resistance in carbapenem-resistant Gram-negative bacilli 
Figure 2. The frequency of resistance in carbapenem-resistant Gram-negative bacilli

 
 

Discussion

Although antibiotic resistance in bacteria isolated from hospitalized patients, as well as bacteria with a direct detrimental effect on human health, has been a research focus in recent years, it is important to know that the development of resistance to antibiotics is a natural ecological phenomenon (26). In response to the Emergence of microbial resistance to various antibiotics, a large number of antibiotics have been produced and introduced over the past two decades (27). Nevertheless, the growing trend of resistance to certain antibiotics on the one hand, and the identification of potentially modifiable factors contributing to microbial resistance, on the other hand, have posed great challenges for physicians (28).
In recent years, there have been many reports of Enterobacteriaceae strains producing carbapenemase enzymes worldwide. Although these enzymes are often found in Klebsiella pneumoniae, there are reports of these enzymes found in other bacteria of this large family, including Enterobacter, Salmonella, and Escherichia coli (28, 29).
There are three main mechanisms by which Gram-negative bacteria resist carbapenems. These include enzymatic hydrolysis of carbapenems by Carbapenemases that are encoded by the following genes: ndmkpc, ampC , vim, oxa, and imp; expression of efflux pumps that actively remove carbapenems from the bacterial cell; and reducing the permeability of bacterial outer membrane through porin loss along with overexpression of ampC and esbl beta-lactamases (29-31).
In a report by Shahcheraghi et al. that studied Enterobacteriaceae isolated from hospitals in Tehran, 3.6% of the samples were resistant to meropenem, 0.3% were resistant to ertapenem, and 1.1% were resistant to imipenem (32). Solgi et al. found that 88% of Enterobacteriaceae, Pseudomonas aeruginosa, and Acinetobacter baumannii strains were resistant to imipenem and meropenem, indicating an increase in bacterial resistance to carbapenems in recent years (33). Also, in the study by Solgi et al., of a total of 44 Gram-negative strains that were resistant to antibiotics, 17 were positive for Carbapenemases. Among these, only four had the imp gene, while none of the other genes (oxa -48, vim, ges, ndm, spm and kpc) were detected in any isolates (33). Kumarasamy and colleagues showed that the prevalence of beta-lactamases (ndm1, vim, and imp) among multidrug-resistant Enterobacteriaceae varies between 31% and 55% (34).
The incidence and prevalence of carbapenem-susceptible Enterobacteriaceae (CSE) could be influenced by geographical factors (35, 36). According to reports from Mexico and Uganda, the prevalence of CSE is about 10%. While CSE rates are reported to be approximately 0.6% in Asia, this rate is 2.93 percent per 100,000 people in the United States (37, 38). Patients with severe illnesses, such as those undergoing mechanical ventilation, intensive care, and transplantation, or those hospitalized for a long time and have had long-term antibiotic use, are at risk for carbapenem-resistant Enterobacteriaceae (CRE) infections (39, 40).


 

Conclusion

Differences in the mention results may be due to variation in clinical samples, study time, and treatment strategies in each geographic area. However, all studies indicate that resistance to most antibiotics has increased in Gram-negative bacteria, including Pseudomonas and Acinetobacter. This could be due to the continuous and inaccurate use of antibiotics in long-term hospitalizations as well as the lack of proper infection control measures in hospitals.
The present study shows that the rate of drug resistance as well as the production of beta-lactamase enzymes in gram-negative strains such as Enterobacteriaceae, Pseudomonas and Acinetobacter is high and therefore the treatment of infections caused by these bacteria may be difficult. Therefore, early detection of carbapenemase-producing bacteria will be important to reduce mortality and the prevalence of multidrug-resistant organisms. In addition, by using the correct pattern of antibiotic use and limiting the use of beta-lactam drugs, especially broad-spectrum cephalosporins, and by using rotational programs of antibiotics, it is hoped that the prevalence of carbapenemase-producing strains and other patterns of drug resistance in different parts of the hospital.


 

Ethics Code

All procedures were approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences, Tehran, Iran (Ethics code: IR.SBMU.MSP.REC.1398.287). All patient information were kept confidential during all stages of the study.

 

Acknowledgment

This research is a part of the efforts of the professors and colleagues of Masih Daneshvari Hospital of Shahid Beheshti University of Medical Sciences. All involved are sincerely thanked.
 

 
 

Conflicts of Interest

There is no conflict of interest between the authors.
 

Funding

None.

 
 
Type of Study: Original Research Article | Subject: Medical Bacteriology
Received: 2022/07/7 | Accepted: 2022/08/18 | ePublished: 2022/09/9

References
1. Bassetti M, Peghin M, Vena A, Giacobbe DR. Treatment of Infections Due to MDR Gram-Negative Bacteria. Front Med (Lausanne). 2019;6:74. [DOI:10.3389/fmed.2019.00074] [PMID] [PMCID]
2. Sheu C-C, Chang Y-T, Lin S-Y, Chen Y-H, Hsueh P-R. Infections Caused by Carbapenem-Resistant Enterobacteriaceae: An Update on Therapeutic Options. Frontiers in Microbiology. 2019;10. [DOI:10.3389/fmicb.2019.00080] [PMID] [PMCID]
3. Jalalvand K, Shayanfar N, Shahcheraghi F, Amini E, Mohammadpour M, Babaheidarian P. Evaluation of Phenotypic and Genotypic Characteristics of Carbapnemases-producing Enterobacteriaceae and Its Prevalence in a Referral Hospital in Tehran City. Iranian Journal of Pathology. 2020;15(2):86-95. [DOI:10.30699/ijp.2020.111181.2188] [PMID] [PMCID]
4. Bassetti M, Vena A, Croxatto A, Righi E, Guery B. How to manage Pseudomonas aeruginosa infections. Drugs Context. 2018;7:212527. [DOI:10.7573/dic.212527] [PMID] [PMCID]
5. Pang Z, Raudonis R, Glick BR, Lin TJ, Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv. 2019;37(1):177-92. [DOI:10.1016/j.biotechadv.2018.11.013] [PMID]
6. Azam MW, Khan AU. Updates on the pathogenicity status of Pseudomonas aeruginosa. Drug Discov Today. 2019;24(1):350-9. [DOI:10.1016/j.drudis.2018.07.003] [PMID]
7. Hernández-González IL, Castillo-Ramírez S. Antibiotic-resistant Acinetobacter baumannii is a One Health problem. The Lancet Microbe. 2020;1(7):e279. [DOI:10.1016/S2666-5247(20)30167-1]
8. Horcajada JP, Montero M, Oliver A, Sorli L, Luque S, Gomez-Zorrilla S, et al. Epidemiology and Treatment of Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa Infections. Clin Microbiol Rev. 2019;32(4). [DOI:10.1128/CMR.00031-19] [PMID] [PMCID]
9. Blanco N, Harris AD, Rock C, Johnson JK, Pineles L, Bonomo RA, et al. Risk Factors and Outcomes Associated with Multidrug-Resistant Acinetobacter baumannii upon Intensive Care Unit Admission. Antimicrob Agents Chemother. 2018;62(1). [DOI:10.1128/AAC.01631-17] [PMID] [PMCID]
10. Sileem AE, Said AM, Meleha MS. Acinetobacter baumannii in ICU patients: A prospective study highlighting their incidence, antibiotic sensitivity pattern and impact on ICU stay and mortality. Egyptian Journal of Chest Diseases and Tuberculosis. 2017;66(4):693-8. [DOI:10.1016/j.ejcdt.2017.01.003]
11. Pot M, Reynaud Y, Couvin D, Ducat C, Ferdinand S, Gravey F, et al. Wide Distribution and Specific Resistance Pattern to Third-Generation Cephalosporins of Enterobacter cloacae Complex Members in Humans and in the Environment in Guadeloupe (French West Indies). Frontiers in Microbiology. 2021;12. [DOI:10.3389/fmicb.2021.628058] [PMID] [PMCID]
12. Rohde AM, Zweigner J, Wiese-Posselt M, Schwab F, Behnke M, Kola A, et al. Incidence of infections due to third generation cephalosporin-resistant Enterobacteriaceae - a prospective multicentre cohort study in six German university hospitals. Antimicrob Resist Infect Control. 2018;7:159. [DOI:10.1186/s13756-018-0452-8] [PMID] [PMCID]
13. Shahandeh Z, Sadighian F, Kalantrai N. Prevalence Escherichia coli, Klebsiella and Enterobacter Species and AmpC-producing Enterobacteriaceae in Clinical Specimens of Hospitals Affiliated to Babol University of Medical Sciences, Iran using Phenotypic and Molecular Methods. Iranian Journal of Medical Microbiology. 2022;16(3):212-20. [DOI:10.30699/ijmm.16.3.212]
14. Kalantari H, Hajizade A, Issazadeh K, Faezi Ghasemi M. A Study on the Prevalence of Vancomycin-resistant Enterococci and Their Antibiotic Resistance Pattern in Recreational Waters in Guilan Province, Iran. Iranian Journal of Medical Microbiology. 2022;16(3):251-8. [DOI:10.30699/ijmm.16.3.251]
15. Breurec S, Bouchiat C, Sire J-M, Moquet O, Bercion R, Cisse MF, et al. High third-generation cephalosporin resistant Enterobacteriaceae prevalence rate among neonatal infections in Dakar, Senegal. BMC Infectious Diseases. 2016;16(1):587. [DOI:10.1186/s12879-016-1935-y] [PMID] [PMCID]
16. Muller AE, Huttner B, Huttner A. Therapeutic Drug Monitoring of Beta-Lactams and Other Antibiotics in the Intensive Care Unit: Which Agents, Which Patients and Which Infections? Drugs. 2018;78(4):439-51. [DOI:10.1007/s40265-018-0880-z] [PMID]
17. Kim SW, Lee JS, Park SB, Lee AR, Jung JW, Chun JH, et al. The Importance of Porins and beta-Lactamase in Outer Membrane Vesicles on the Hydrolysis of beta-Lactam Antibiotics. Int J Mol Sci. 2020;21(8). [DOI:10.3390/ijms21082822] [PMID] [PMCID]
18. Tsivkovski R, Totrov M, Lomovskaya O. Biochemical Characterization of QPX7728, a New Ultrabroad-Spectrum Beta-Lactamase Inhibitor of Serine and Metallo-Beta-Lactamases. Antimicrob Agents Chemother. 2020;64(6). [DOI:10.1128/AAC.00130-20] [PMID] [PMCID]
19. Seyfi B, Hossainpour H, Kooti S, Azizi Jalilian F. Identification of Carbapenem Resistance Genes in Escherichia coli Isolated from Blattella germanica by Dot Blot Assay in Hamadan Hospitals, Iran - 2018. Iranian Journal of Medical Microbiology. 2022;16(4):357-62. [DOI:10.30699/ijmm.16.4.357]
20. Borman AM, Muller J, Walsh-Quantick J, Szekely A, Patterson Z, Palmer MD, et al. MIC distributions for amphotericin B, fluconazole, itraconazole, voriconazole, flucytosine and anidulafungin and 35 uncommon pathogenic yeast species from the UK determined using the CLSI broth microdilution method. Journal of Antimicrobial Chemotherapy. 2020;75(5):1194-205. [DOI:10.1093/jac/dkz568] [PMID]
21. Hossein H, Kamran M, Maryam N, Fatemeh N, Abdolreza M, Naghmeh B. Bevacizumab Inhibits Angiogenic Cytokines in Head and Neck Squamous Cell Carcinoma: From Gene to the Protein. International Journal of Hematology-Oncology and Stem Cell Research. 2018;12(2).
22. Karimi S, Bahrami N, Sharifi K, Daustany M, Baghbani-Arani F, Kazempour M, et al. Investigating gene expression level of MUC1 and CEA in pleural fluid of NSCLC lung cancer patients with real-time RT-PCR method. Minerva Pneumol. 2017;56(1):18-24. [DOI:10.23736/S0026-4954.16.01772-7]
23. Farzanegan B, Bahrami N, Birjandi B, Khosravi A, Nasab AF, Fathi M, et al. Down-Expression of miRNA-98 and Over-Expression of miRNA-9 Can Result in Inadequate Immune System Response against Lung Cancer. Biointerface Res Appl Chem. 2021;11:13893-902. [DOI:10.33263/BRIAC116.1389313902]
24. Ghadimi K, Bahrami N, Fathi M, Farzanegan B, Naji T, Emami M, et al. Diagnostic value of LunX mRNA and CEA mRNA expression in pleural fluid of patients with non-small cell lung cancer. Minerva Pneumologica. 2017;56(2):90-5. [DOI:10.23736/S0026-4954.16.01773-9]
25. Wright GD. Mechanisms of resistance to antibiotics. Curr Opin Chem Biol. 2003;7(5):563-9. [DOI:10.1016/j.cbpa.2003.08.004] [PMID]
26. Corona F, Martinez JL. Phenotypic Resistance to Antibiotics. Antibiotics (Basel). 2013;2(2):237-55. [DOI:10.3390/antibiotics2020237] [PMID] [PMCID]
27. Nordmann P. Carbapenemase-producing Enterobacteriaceae: overview of a major public health challenge. Med Mal Infect. 2014;44(2):51-6. [DOI:10.1016/j.medmal.2013.11.007] [PMID]
28. Yuan W, Zhang Y, Riaz L, Yang Q, Du B, Wang R. Multiple antibiotic resistance and DNA methylation in Enterobacteriaceae isolates from different environments. J Hazard Mater. 2021;402:123822. [DOI:10.1016/j.jhazmat.2020.123822] [PMID]
29. Perovic O, Ismail H, Quan V, Bamford C, Nana T, Chibabhai V, et al. Carbapenem-resistant Enterobacteriaceae in patients with bacteraemia at tertiary hospitals in South Africa, 2015 to 2018. Eur J Clin Microbiol Infect Dis. 2020;39(7):1287-94. [DOI:10.1007/s10096-020-03845-4] [PMID]
30. Oliveira RA, Ng KM, Correia MB, Cabral V, Shi H, Sonnenburg JL, et al. Klebsiella michiganensis transmission enhances resistance to Enterobacteriaceae gut invasion by nutrition competition. Nat Microbiol. 2020;5(4):630-41. [DOI:10.1038/s41564-019-0658-4] [PMID]
31. Shahcheraghi F, Aslani MM, Mahmoudi H, Karimitabar Z, Solgi H, Bahador A, et al. Molecular study of carbapenemase genes in clinical isolates of Enterobacteriaceae resistant to carbapenems and determining their clonal relationship using pulsed-field gel electrophoresis. J Med Microbiol. 2017;66(5):570-6. [DOI:10.1099/jmm.0.000467] [PMID]
32. Solgi H, Badmasti F, Aminzadeh Z, Giske CG, Pourahmad M, Vaziri F, et al. Molecular characterization of intestinal carriage of carbapenem-resistant Enterobacteriaceae among inpatients at two Iranian university hospitals: first report of co-production of bla NDM-7 and bla OXA-48. Eur J Clin Microbiol Infect Dis. 2017;36(11):2127-35. [DOI:10.1007/s10096-017-3035-3] [PMID]
33. Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. The Lancet Infectious Diseases. 2010;10(9):597-602. [DOI:10.1016/S1473-3099(10)70143-2]
34. Rouhi S, Ramazanzadeh R. Prevalence of blaOxacillinase-23 and blaOxacillinase-24/40 carbapenemase genes in Pseudomonas aeruginosa isolated from patients with nosocomial and non-nosocomial infections in West of Iran. Iranian Journal of Pathology. 2018;13(3):348-56.
35. Lashtoo Aghaee B, Alikhani MY, van Leeuwen WB, Mojtahedi A, Kazemi S, Karami P. Conventional Treatment of Burn Wound Infections versus Phage Therapy. Iranian Journal of Medical Microbiology. 2022;16(3):186-96. [DOI:10.30699/ijmm.16.3.186]
36. Guh AY, Bulens SN, Mu Y, Jacob JT, Reno J, Scott J, et al. Epidemiology of Carbapenem-Resistant Enterobacteriaceae in 7 US Communities, 2012-2013. JAMA. 2015;314(14):1479-87. [DOI:10.1001/jama.2015.12480] [PMID] [PMCID]
37. Torres-Gonzalez P, Cervera-Hernandez ME, Niembro-Ortega MD, Leal-Vega F, Cruz-Hervert LP, Garcia-Garcia L, et al. Factors Associated to Prevalence and Incidence of Carbapenem-Resistant Enterobacteriaceae Fecal Carriage: A Cohort Study in a Mexican Tertiary Care Hospital. PLoS One. 2015;10(10):e0139883. [DOI:10.1371/journal.pone.0139883] [PMID] [PMCID]
38. Gupta N, Limbago BM, Patel JB, Kallen AJ. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clin Infect Dis. 2011;53(1):60-7. [DOI:10.1093/cid/cir202] [PMID]
39. Iovleva A, Doi Y. Carbapenem-Resistant Enterobacteriaceae. Clin Lab Med. 2017;37(2):303-15. [DOI:10.1016/j.cll.2017.01.005] [PMID] [PMCID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc