Iranian Journal of Medical Microbiology

T Ten bacterial isolates obtained from previous studies, confirmed as C. diphtheria and with the ability to produce toxins (14, 15), were used in this study. To amplify the dtxR gene, genomic bacterial DNA was extracted and purified by using a Qiamp DNA Mini Kit (Qiagen) according to the manufacturer’s instruction, with a final elution of 100 µl, and stored at -35^oC until used.
Polymerase chain reaction (PCR) was performed using the primers (dtxRF [CCAGCACACAACAGTCTCCA] and dtxRR [CATCTAATTTCGCCGCCTTT]). The DNA sequencing was performed using the same forward and reverse primers as used for PCR, and the obtained DNA sequences were analyzed via overlapping editing using SeqScap v. 2.7 (Applied Biosystems).
The software packages BioEdit 7.0.5.3 and Mega X were used to analyze DNA mutations and phylogenetic trees, respectively. Phylogenetic tree analysis was done using the neighbor-joining method. The maximum composite likelihood method and the units of the number of base substitutions per site were used to compute the evolutionary distances. The phylogenetic tree was generated with 1,000 bootstraps. The sequences obtained in this study were deposited at GenBank under the following accession numbers (sample IDs): MT713126 (12), MT713127 (13), MT713128 (16), MT713129 (22), MT713130 (28), MT713131 (45), MT713132 (47), MT713133 (68), MT713134 (85), and MT713135 (86).
Strains from other countries for comparison were obtained from GenBank, with the following accession numbers (strains): CP003216.1 (PW8), CP020410.2 (FDAARGOS_197), CP003210.1 (C7), M80337.1(1030), M80336.1 (C7hm723), CP003209.1 (BH8), CP003211.1 (CDCE 8392), CP003208.1 (INCA 402), CP003206.1 (31A), CP003217.1 (VA01), CP003207.1 (241), CP003212.1 (HC01), CP003213.1 (HC02), CP003214.1 (HC03), CP003215.1 (HC04), LR134538.1 (NCTC 3529), LR134537.1 (NCTC 7838), LN831026.1 (NCTC11397), BX248355.1 (NCTC13129), NZ_JAQO01000005.1 (ISS3319), CP029644.1 (BQ11), KU869771.1 (M2871), KU869772.1 (M5840), CP018331.1 (B-D-16-78), CP038504.1 (TH1526), CP039522.1 (CN2000), HM231328.1 (IR74), KU869772.1 (6732), and KY817830.1(2-15).
 
 

Based on the results, the amplicon size of the dtxR gene was 752 bp. This amplicon product was confirmed by electrophoresis (Figure 1).

 

 
Figure 1. PCR products of the dtxR gene sequence (752 bp). bp: base pair; M: DNA Ladder (from bottom to top: 100–1000 bp); 12, 13, 16, 22, 28, 45, 47, 68, 85, and 86:10 isolates.
 

Based on the dtxR sequence, phylogenetic tree analysis was performed. The result showed that all strains in this study could be divided into seven clades – clades I, II, III, IV, V, VI, and VII (Figure 2), whereas 10 isolates of C. diphtheriae analyzed were divided into three clades (Clades I, II, and IV). Isolate numbers 13, 16, 22, 47, 86, and 12 belonged to the same clade and were related to strains from Brazil (HC01, CDCE8392, 241), Romania (6732ROM), India (TH1526), Australia (M5840), and Russia (215RUS). Isolate numbers 45, 68, and 85, located in Clade II, were related to strains from India (IR74), Brazil (HC02 dan 31A), the UK (ISS3319 and NCTC11397), the USA (C7 and C7hm723), and Boston (C7Bos). Isolate number 28, located in Clade IV, was associated with strains from the USA (PW8/vaccine strain), Brazil (BH8, INCA402), the UK (NCTC3529), Australia (BQ11 dan and M2871), Malaysia (BD1678), and India (CN2000). All isolates had mutation pattern 2 (Table 1), which was the dominant mutation pattern located in the same clade (Figure 2). Isolate numbers 45, 68, and 85, located in Clade II (Figure 2), also had the same mutation pattern (Table 1).

 

Table 1. Mutation positions of nucleic acids of the C. diphtheriae dtxR gene.

Mutation Types	DNA Mutation Positions			Amino Acid Changes	Isolate IDs
	255	273	639
1	T	C	C	No	PW8, 28
2	C	T	A	No	12, 13, 16, 22, 47, 86
3	-	T	-	No	45, 68, 85

PW8: referral strain; C: cytosine; T: thymine; A: adenine
 

 
Figure 2. A phylogenetic tree based on the dtxR gene (681 bp) of C. diphtheria strains. The strains analyzed in this study were 12, 13, 16, 22, 28, 45, 47, 68, 85, and 86, and the other symbols represent the reference strains taken from GenBank data.

 

All isolates analyzed in this study shared similarities with strains from other countries. Nakao and Sunarno reported that the sequence of dtxR could show the diversity of C. diphtheria strains (7, 13). Instead of phylogenetic analysis, the gold standards to show the phylogenetic relationship among strains are 16 sRNA and rpoB gene analysis (16). Moreover, to obtain valid and comprehensive conclusions on the genetic relationships of C. diphtheria, characterization based on several virulence genes, multilocus sequence typing, and/or whole-genome analysis are required (17). Therefore, in this study, the phylogenetic analysis only predicts and shows the diversity of strains rather than describing the true phylogenetic relationship.
Mutations in the dtxR gene could affect not only the production of DtxR but also the toxin expression (18). However, in this study, the mutation in the dtxR sequence was silent, and there was no change in the amino acids sequence (Table 1). Therefore, mutations that occurred in the dtxR gene did not affect the DtxR function as a repressor of toxin synthesis. This result is in agreement with the finding of Muliastuti and Sunarno, who detected no amino acid substitution of DtxR protein in isolates from the outbreak in Indonesia (8, 14). Based on that, it can be proposed that the dtxR sequences found in Jakarta are preserved. Although these results differ from those found in other countries, it is possible that the geographic area influences the occurrence of mutations. However, this assumption needs to be confirmed by further research.

 
 

No mutations showed amino acid changes. We propose that the dtxR protein is conserved among bacterial strains isolated from Jakarta.

 

Hibah PITTA 2019 Universitas Indonesia (No. NKB-0521/UN2.R3.1/HKP.05.00/2019).
 

None.

 

Conflicts of Interest

The authors declare no conflicts of interest.