year 17, Issue 2 (March - April 2023)                   Iran J Med Microbiol 2023, 17(2): 262-266 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Yasmon A, Evriarti P R, Rosanna Y. Diphtheria Toxin Repressor (dtxR) Gene-Based Genetic Diversity of Corynebacterium diphtheriae Isolated in Jakarta, Indonesia, 2018–2019. Iran J Med Microbiol 2023; 17 (2) :262-266
URL: http://ijmm.ir/article-1-1795-en.html
1- Department of Microbiology, Faculty of Medicine, Universitas Indonesia/Cipto Mangunkusumo Hospital. Jl.Pegangsaan Timur 16, Cikini, Jakarta Pusat 10320, Jakarta,Indonesia , andiyasmon@gmail.com
2- Biomedical Science Graduate Program, Faculty of Medicine, Universitas Indonesia, Jl. Salemba Raya No.5, Jakarta Pusat 10320, Jakarta, Indonesia
3- Department of Microbiology, Faculty of Medicine, Universitas Indonesia/Cipto Mangunkusumo Hospital. Jl.Pegangsaan Timur 16, Cikini, Jakarta Pusat 10320, Jakarta, Indonesia
Full-Text [PDF 450 kb]   (740 Downloads)     |   Abstract (HTML)  (2229 Views)
Full-Text:   (716 Views)
Introduction


Corynebacterium diphtheriae is the most common toxin-producing bacterial species that causes diphtheria (1) From 2016 to early 2018, the WHO reported that the number of diphtheria cases was higher as compared to 2 years earlier (15,928 to 12,309 cases) (2) Indonesia ranked second, with 954 cases, in 2017 (3) These data indicate that diphtheria is still persistent, irrespective of the vaccination program. A previous study reported that the administration of DTP3 high-dose vaccination did not result in significant differences in the protection of long-term immunity compared to low-dose vaccination (4) Fitriansyah also reported similar results: some diphtheria patients had a complete immunization history (5) Variations of bacterial virulence factors, especially the toxin, are the most likely causes of the low effectivity of the vaccine (6) Nakao et al. reported that one factor that affects the variation of bacterial virulence is the presence of mutations in the diphtheria toxin repressor (dtxR) gene influencing toxin expression (7, 8).
The DtxR (226 AA) is an iron-dependent -repressor protein that regulates diphtheria toxin synthesis (9). Previous studies reported that amino acid substitution in the DtxR protein caused decreased repressor activity (10). Kolodkina et al. reported the missense mutation in the dtxR sequence on the strain of Corynebacterium that produces a toxin at high concentrations (11). Kombrova et al. and Nakao et al. (1997) also found a mutation in the dtxR gene of Corynebacterium that caused an outbreak (7, 12). In Indonesia, Sunarno et al., who performed partial dtxR characterization (200 bp) in 2014, found a variety of mutations in dtxR (13). Moreover, in 2017, Mulyastuti et al. found a mutation of the dtxR gene in the complete dtxR characterization (678 bp) using four isolated samples from diphtheria patients and contacts in outbreak areas between 2013 and 2014 (8). This study aims to characterize the dtxR gene from C. diphtheriae isolated from diphtheria patients in Jakarta from 2018 to 2019.


 

Materials and Methods

T Ten bacterial isolates obtained from previous studies, confirmed as C. diphtheria and with the ability to produce toxins (14, 15), were used in this study. To amplify the dtxR gene, genomic bacterial DNA was extracted and purified by using a Qiamp DNA Mini Kit (Qiagen) according to the manufacturer’s instruction, with a final elution of 100 µl, and stored at -35oC until used.
Polymerase chain reaction (PCR) was performed using the primers (dtxRF [CCAGCACACAACAGTCTCCA] and dtxRR [CATCTAATTTCGCCGCCTTT]). The DNA sequencing was performed using the same forward and reverse primers as used for PCR, and the obtained DNA sequences were analyzed via overlapping editing using SeqScap v. 2.7 (Applied Biosystems).
The software packages BioEdit 7.0.5.3 and Mega X were used to analyze DNA mutations and phylogenetic trees, respectively. Phylogenetic tree analysis was done using the neighbor-joining method. The maximum composite likelihood method and the units of the number of base substitutions per site were used to compute the evolutionary distances. The phylogenetic tree was generated with 1,000 bootstraps. The sequences obtained in this study were deposited at GenBank under the following accession numbers (sample IDs): MT713126 (12), MT713127 (13), MT713128 (16), MT713129 (22), MT713130 (28), MT713131 (45), MT713132 (47), MT713133 (68), MT713134 (85), and MT713135 (86).
Strains from other countries for comparison were obtained from GenBank, with the following accession numbers (strains): CP003216.1 (PW8), CP020410.2 (FDAARGOS_197), CP003210.1 (C7), M80337.1(1030), M80336.1 (C7hm723), CP003209.1 (BH8), CP003211.1 (CDCE 8392), CP003208.1 (INCA 402), CP003206.1 (31A), CP003217.1 (VA01), CP003207.1 (241), CP003212.1 (HC01), CP003213.1 (HC02), CP003214.1 (HC03), CP003215.1 (HC04), LR134538.1 (NCTC 3529), LR134537.1 (NCTC 7838), LN831026.1 (NCTC11397), BX248355.1 (NCTC13129), NZ_JAQO01000005.1 (ISS3319), CP029644.1 (BQ11), KU869771.1 (M2871), KU869772.1 (M5840), CP018331.1 (B-D-16-78), CP038504.1 (TH1526), CP039522.1 (CN2000), HM231328.1 (IR74), KU869772.1 (6732), and KY817830.1(2-15).

 
 

Results and Discussion

Based on the results, the amplicon size of the dtxR gene was 752 bp. This amplicon product was confirmed by electrophoresis (Figure 1).
 
Figure 1. PCR products of the dtxR gene sequence (752 bp). bp: base pair; M: DNA Ladder (from bottom to top: 100–1000 bp); 12, 13, 16, 22, 28, 45, 47, 68, 85, and 86:10 isolates. 
Figure 1. PCR products of the dtxR gene sequence (752 bp). bp: base pair; M: DNA Ladder (from bottom to top: 100–1000 bp); 12, 13, 16, 22, 28, 45, 47, 68, 85, and 86:10 isolates.
 
Based on the dtxR sequence, phylogenetic tree analysis was performed. The result showed that all strains in this study could be divided into seven clades – clades I, II, III, IV, V, VI, and VII (Figure 2), whereas 10 isolates of C. diphtheriae analyzed were divided into three clades (Clades I, II, and IV). Isolate numbers 13, 16, 22, 47, 86, and 12 belonged to the same clade and were related to strains from Brazil (HC01, CDCE8392, 241), Romania (6732ROM), India (TH1526), Australia (M5840), and Russia (215RUS). Isolate numbers 45, 68, and 85, located in Clade II, were related to strains from India (IR74), Brazil (HC02 dan 31A), the UK (ISS3319 and NCTC11397), the USA (C7 and C7hm723), and Boston (C7Bos). Isolate number 28, located in Clade IV, was associated with strains from the USA (PW8/vaccine strain), Brazil (BH8, INCA402), the UK (NCTC3529), Australia (BQ11 dan and M2871), Malaysia (BD1678), and India (CN2000). All isolates had mutation pattern 2 (Table 1), which was the dominant mutation pattern located in the same clade (Figure 2). Isolate numbers 45, 68, and 85, located in Clade II (Figure 2), also had the same mutation pattern (Table 1).
 
Table 1. Mutation positions of nucleic acids of the C. diphtheriae dtxR gene.
Mutation Types DNA Mutation Positions Amino Acid Changes Isolate IDs
255 273 639
1 T C C No PW8, 28
2 C T A No 12, 13, 16, 22, 47, 86
3 - T - No 45, 68, 85
PW8: referral strain; C: cytosine; T: thymine; A: adenine
 
Figure 2. A phylogenetic tree based on the dtxR gene (681 bp) of C. diphtheria strains. The strains analyzed in this study were 12, 13, 16, 22, 28, 45, 47, 68, 85, and 86, and the other symbols represent the reference strains taken from GenBank data. 
Figure 2. A phylogenetic tree based on the dtxR gene (681 bp) of C. diphtheria strains. The strains analyzed in this study were 12, 13, 16, 22, 28, 45, 47, 68, 85, and 86, and the other symbols represent the reference strains taken from GenBank data.
 

All isolates analyzed in this study shared similarities with strains from other countries. Nakao and Sunarno reported that the sequence of dtxR could show the diversity of C. diphtheria strains (7, 13). Instead of phylogenetic analysis, the gold standards to show the phylogenetic relationship among strains are 16 sRNA and rpoB gene analysis (16). Moreover, to obtain valid and comprehensive conclusions on the genetic relationships of C. diphtheria, characterization based on several virulence genes, multilocus sequence typing, and/or whole-genome analysis are required (17). Therefore, in this study, the phylogenetic analysis only predicts and shows the diversity of strains rather than describing the true phylogenetic relationship.
Mutations in the dtxR gene could affect not only the production of DtxR but also the toxin expression (18). However, in this study, the mutation in the dtxR sequence was silent, and there was no change in the amino acids sequence (Table 1). Therefore, mutations that occurred in the dtxR gene did not affect the DtxR function as a repressor of toxin synthesis. This result is in agreement with the finding of Muliastuti and Sunarno, who detected no amino acid substitution of DtxR protein in isolates from the outbreak in Indonesia (8, 14). Based on that, it can be proposed that the dtxR sequences found in Jakarta are preserved. Although these results differ from those found in other countries, it is possible that the geographic area influences the occurrence of mutations. However, this assumption needs to be confirmed by further research.

 
 

Conclusion

No mutations showed amino acid changes. We propose that the dtxR protein is conserved among bacterial strains isolated from Jakarta.

 

Acknowledgment

Hibah PITTA 2019 Universitas Indonesia (No. NKB-0521/UN2.R3.1/HKP.05.00/2019).
 

 

Funding

None.

 

Conflicts of Interest

The authors declare no conflicts of interest.


 

Type of Study: Brief Original Article | Subject: Molecular Microbiology
Received: 2022/07/27 | Accepted: 2022/12/23 | ePublished: 2023/03/30

References
1. Sharma NC, Efstratiou A, Mokrousov I, Mutreja A, Das B, Ramamurthy T. Diphtheria (Primer). Nat Rev Dis Primers. 2019;5(1). [DOI:10.1038/s41572-019-0131-y] [PMID]
2. Clarke KEN. Review of the epidemiology of diphtheria 2000-2016. World Health Organ. 2017:2021-05.
3. Karyanti MR, Nelwan EJ, Assyidiqie IZ, Satari HI, Hadinegoro SR. Diphtheria epidemiology in Indonesia during 2010-2017. Acta Med Indones. 2019;51(3):205-13.
4. Hughes GJ, Mikhail AFW, Husada D, Irawan E, Kafatos G, Bracebridge S, et al. Seroprevalence and determinants of immunity to diphtheria for children living in two districts of contrasting incidence during an outbreak in East Java, Indonesia. Pediatr Infect Dis J. 2015;34(11):1152-6. [DOI:10.1097/INF.0000000000000846] [PMID]
5. Fitriansyah A. The description of Diphtheria immunization history to Diphtheria patients in Surabaya at 2017. J Berk Epidemiol. 2018;6(2):103. [DOI:10.20473/jbe.V6I22018.103-111]
6. WHO. Immunization, Vaccine, and Biologicas Diphtheriae. 2019.
7. Nakao H, Mazurova IK, Glushkevich T, Popovic T. Analysis of heterogeneity of Corynebacterium diphtheriae toxin gene, tox, and its regulatory element, dtxR, by direct sequencing. Res Microbiol. 1997;148(1):45-54. [DOI:10.1016/S0923-2508(97)81899-2] [PMID]
8. Mulyastuti Y, Rahayu SI, Sunarno S, Wasito EB. Investigation of Diphtheria in Indonesia: dtxR and tox genes analysis of corynebacterium diphtheriae collected from outbreaks. Biodivers J Biol Divers. 2017;18(2):784-7. [DOI:10.13057/biodiv/d180247]
9. Sabbadini PS, Genovez MRN, Silva CFd, Adelino TLN, Santos CSd, Pereira GA, et al. Fibrinogen binds to nontoxigenic and toxigenic Corynebacterium diphtheriae strains. Mem Inst Oswaldo Cruz. 2010;105:705-11. [DOI:10.1590/S0074-02762010000500018] [PMID]
10. Love JF, VanderSpek JC, Marin V, Guerrero L, Logan TM, Murphy JR. Genetic and biophysical studies of diphtheria toxin repressor (DtxR) and the hyperactive mutant DtxR(E175K) support a multistep model of activation. Proc Natl Acad Sci. 2004;101(8):2506-11. [DOI:10.1073/pnas.0303794101] [PMID] [PMCID]
11. Kolodkina VL, Titov LP, Sharapa TN, Drozhzhina ON. Point mutations in tox promoter/operator and diphtheria toxin repressor (DTXR) gene associated with the level of toxin production by Corynebacterium diphtheriae strains isolated in Belarus. Mol Gen Mikrobiol Virusol. 2007(1):22-9. [DOI:10.3103/S0891416807010041]
12. Siu K, Oiu B, Mel'nikov VG, Gubina NI, Loseva LV, Mazurova IK. Polymorphism of tox and dtxR genes in circulating strains of Corynebacterium diphtheriae. Zh Mikrobiol Epidemiol Immunobiol. 2009(1):7-11.
13. Sunarno S, Mulyastuti Y, Puspandari N, Sariadji K. DNA sequence analysis of dtxR gene (partial) of Corynebacterium diphtheriae causing diphtheria in Jawa and Kalimantan Islands, Indonesia. Indones Biomed J. 2017;9(2):91-8. [DOI:10.18585/inabj.v9i2.268]
14. Yasmon A, Rosana Y, Usman D, Prilandari LI, Hartono TS. Identification and phylogenetic analysis of Corynebacterium diphtheriae isolates from Jakarta, Indonesia based on partial rpoB gene. Biodivers J Biol Divers. 2020;21(7). [DOI:10.13057/biodiv/d210726]
15. Rosana Y, Prilandari LI, Ajisman R, Hartono TS, Yasmon A. Detection of toxin-producing Corynebacterium diphtheriae from throat swabs of diphtheria patients using duplex real-time PCR. Iran J Microbiol. 2020;12(6):508-15. [DOI:10.18502/ijm.v12i6.5024] [PMID] [PMCID]
16. Zasada AA, Mosiej E. Contemporary microbiology and identification of Corynebacteria spp. causing infections in human. Lett Appl Microbiol. 2018;66(6):472-83. [DOI:10.1111/lam.12883] [PMID]
17. du Plessis M, Wolter N, Allam M, de Gouveia L, Moosa F, Ntshoe G, et al. Molecular Characterization of Corynebacterium diphtheriae Outbreak Isolates, South Africa, March-June 2015. Emerg Infect Dis. 2017;23(8):1308-15. [DOI:10.3201/eid2308.162039] [PMID] [PMCID]
18. Wang Z, Schmitt MP, Holmes RK. Characterization of mutations that inactivate the diphtheria toxin repressor gene (dtxR). Infect Immun. 1994;62(5):1600-8. [DOI:10.1128/iai.62.5.1600-1608.1994] [PMID] [PMCID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc