Iranian Journal of Medical Microbiology

DNA Extraction

At this stage, 100 samples of negatively cultured endocarditis were collected from selected military hospitals. DNA extraction from C. burnetii bacteria was performed with the DNP extraction kit of Sinaclon Company (Iran, DNP; lot No. EX6071) and according to the kit instructions. The concentration and quality of the obtained DNA were measured using a nanodrop device.

Primer Design

For PCR, the primers were designed using Gene runner software (version 2) and CLC sequence viewer (version 6) and made by Sinaclone. In order to finalize the designed primers and ensure their specificity, the primers were blasted using the information registered on the NCBI website, and their accuracy was confirmed.

Amplification and Isolation of IS1111 C. burnetii Gene

For each PCR, 25 μL of reaction mixture consisting of 12.5 μL of Master mixture, 1 μL of each primer (cox-F: 5'- GATCATTTGGGCGCTTTTAAC - 3 'and cox-R: 5'- CATCAGCCCTCATTGTTTCG concentration -3') 10 picomoles, 5 μL of template DNA and 5.5 μL of water were prepared by PCR. Two samples were prepared for the positive control (C. burneii; 126 bp) and negative (instead of DNA equivalent water was added) (21).
PCR according to the method (21) under initial denaturation at 94°C for 3 minutes, followed by 35 denaturation cycles at 94°C for 30 seconds, annealing at 52°C for 35 seconds, and expansion at 72°C for 35 seconds, the final extension was performed at 72°C for 5 minutes. Then electrophoresis was performed on 2% agarose gel, and the gel was stained with Red Safe (22).

Positive Control Synthesis

Due to the fact that a positive sample was not available for bacteria, positive control for these bacteria was synthesized based on the sequence of primers and prepared in PUC 18 vector.
GATCATTTGGGCGCTTTTAACACGCCAAGAAACGTATCGCTGTGGCGCCTAAACACCGCCGTGGGTATAAAAAAAGAATTAACAAAAGGAGACACACCAACCGAGTTCGAAACAATGAGGGCTGATG

Feature Determination

 In order to evaluate the specificity of primers and determine the specificity of the method, PCR reaction with the conditions mentioned above was performed on the genome of negative control samples. Also, to ensure the ability of the extracted DNA to be used in the PCR reaction and the absence of inhibitors, the PCR reaction on the DNA of bacteria (Staphylococcus aureus (ATCC 25923), Bacillus subtilis (ATCC 6051), Shigella sonnei (ATCC 9290), Escherichia coli (ATCC 25922), Enterobacter faecalis ATCC 29212) and Pseudomonas aeruginosa (ATCC 27853) were performed.

IS1111 Gene Cloning C. burnetiii

To clone a portion of the IS1111 C. burnetiii amplified gene in plasmid PUC 18, the PCR product was first purified using the Bioneer gel extraction kit protocol (South Korea, Cat No. K3037 AccuPrep® PCR / Gel Purification Kit). Cloning was performed using SinaClon TA Cloning Kit (Iran, SinaClon TA Cloning Kit; Cat No. CL5841) according to the kit instructions and with PUC 18 vector. After ligation, JM107 E. coli susceptible to calcium chloride was used to accept the plasmid containing the gene (23).
After susceptibility of the bacteria to plasmid acceptance, 10 μL of the plasmids containing the gene was added to the microtube containing the susceptible bacterium, and finally, the recombinant plasmid was transferred into the bacterium using heat shock. The bacteria were then placed in a sugar incubator at (150 rpm, 3h, 37° C) for 60 minutes. Transformed bacteria were cultured on LB Broth medium containing Ampicillin antibiotic. The culture medium was then centrifuged at 9000 rpm for 2 minutes. From residual precipitate on plate surface (50 mL) LB agar containing (50 mg/mL) Ampicillin 100L, 100L X-gal (20 mg/mL), 80L IPTG (24 mg/mL) and Tet (10 mg/mL) 100 L, Added and broadcast. The plate was placed in a sugar incubator at 37°C for 16 hours.
The following methods were used to confirm the cloning and transfer of recombinant plasmids into bacteria:

Formation of White Colonies Containing Recombinant Vectors

After culture, the transformed bacteria are seen in the culture medium of blue colonies (colony without recombinant plasmid) and white (colonies containing recombinant plasmid).
For PCR colony, 2 to 3 white colonies from the transformation stage were selected, and PCR reaction was performed using PCR Master mix (Ampliqon; Cat. No.: A190303). The product was then electrophoresed in 1% agarose gel to confirm the presence of the cloned fragment.

Extraction of Recombinant Plasmid

Plasmid extraction was performed after confirmation of the presence of recombinant and inserted plasmids using ViVantis Plasmid Extraction Kit (Malaysia, Plasmid DNA Extraction Kit; Cat No. GF-PL-050 GF-1). In the quantitative evaluation of plasmid extraction, the first 1:10 and 1:100 dilutions were obtained from the plasmid extraction sample. After reading the concentrations of the dilutions prepared by the nanodrop device, the final concentration of the extracted plasmid was obtained in a volume of 100 microliters.

Sensitivity and Detection Limit

To determine the sensitivity and limit of detection (LOD), the minimum number of copies of the desired fragment that can create a clear band in the PCR reaction was calculated. For this purpose, successive double dilutions (1-10 to 10-10) of PUC18 plasmid with specific concentrations were prepared, and PCR was performed using them. Its products were electrophoresed on 1% agarose gel. The last dilution in which the PCR product bonds will be the LOD that can be obtained with CN = MN / LD, the least number of traceable copies.

DNA Extraction

Pure DNA was obtained using a nanodrop device for samples from patients with endocarditis (Figure 1). By examining the result of quantitative DNA analysis, its amount was calculated between 1.69 and 1.8.

 
Figure 1. Extracted DNA sample (L: DNA Ladder and 1-5: Purified DNA)

 
Based on the collected samples, endocarditis was examined for the presence of C. burnetii in these patients. Still, out of 60 samples, no positive samples were reported for any of these factors.

Specification

In order to investigate the specificity for each pair of primers, PCR reaction with the conditions related to each gene was performed on the genome of the negative control bacteria extracted. Still, no band was observed after electrophoresis of PCR products related to each gene on the agarose gel (Figure 2). This indicates that the designed primers attach only to the target bacterium.
 

 
Figure 2. Specification for C. burnetiid. Negative control bacteria from left to right L size marker, C. burnetii, Staphylococcus aureus, Bacillus subtilis, Shigella sonnei, Escherichia coli, Enterobacter faecalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, respectively

 

Determine LOD

The last dilution of PUC18 plasmid for C. burnetii with an initial concentration of 700 ng/µL, which formed a detectable band on the gel, was calculated to be 7-10, and the minimum number of detectable copies in a 25 μL PCR reaction equal to 22 copies.
 

 

 

Fever is an emerging and emerging zoonosis in many countries, including Iran. Determining the prevalence of infection and risk factors makes the importance of infection for health officials, and the necessary facilities and equipment for control and prevention as well as research priorities are identified (24, 25). The results of studies show that the one-step PCR method for the diagnosis of C. burnetii is not sensitive enough, and it is recommended to use the nested PCR method. This method has high speed, accuracy, specificity, and sensitivity compared to classical methods (26, 27).
In recent years, many studies have been performed to identify C. burnetii, which has been identified in various infected samples. Still, few cases of this bacterium have been studied in hospital samples (28, 29). In the study conducted by Kirkan et al., in 2011. Of 296 samples, 12 (4%) were positive (30). Astobiza et al., in a study of 178 samples in Spain, showed that 119 of the 178 suspected cases were positive for the presence of anti-C. burnetii antibodies (26, 31). Dosti et al. conducted a study on 130 camel blood samples. In this study, 14 cases (10.76%) of camel blood samples by PCR were positive for the presence of C. burnetii (32). In 2012, Giuraniks et al. Conducted a study in Hungary on 215 samples, 7 of which 67% were positive for C. burnetii (33).
Literak had not seen any human infection with Coxsackie in the Czech Republic and Slovakia in the five years leading up to 1996 (39). However, in his report, Hirai reports a positive increase in cases of human infection with C. burnetii in Japan in recent years (39). In a 1999 scientific study in Japan, his colleagues noted that 33% of those tested were infected with the microorganism (40). Guo et al. also detected coxsackie infection in 1998 in 3.4% of sheep farmers in North Dakota (USA) (41).
The bacterium has QPRH1 plasmids in acute infection, and the disease develops as atypical pneumonia. QPRH1 is related to the acute form of the disease; this group is sensitive to chloramphenicol and tetracycline. The bacterium contains QPRS plasmids in chronic infection, and the disease develops as chronic endocarditis years later. This group of plasmids is resistant to chloramphenicol and tetracycline. The third group without plasmids is involved in causing chronic disease. Endocarditis is the main clinical manifestation of chronic Q fever and can lead to death in more than 65% of patients if left untreated (42-44). Therefore, the diagnosis of genes in acute or chronic forms of the disease is very important in developing drug resistance, which is one of the major medical problems today (45). The absence of Query Fever at the time of the study and in the past, or the absence of specific clinical symptoms related to Query Fever in the past, are consistent with the results of this study (39).
In this study, C. burnetii was not detected in any blood samples. However, C. burnetii has a wide and varied host spectrum in the Epizootic and Enzootic foci. Comparing the results of our study with the previous research works of researchers in Iran and other countries also reveals obvious differences or relative similarities. Each pathogen's enzootic (native animal) cycles, including C. burnetii, are different in reservoir hosts in different regions. Accordingly, statistics show significant differences in the prevalence of coxsackie in different geographical areas.

 

Based on the initial serological evidence obtained, it seems that Q fever is currently present in Iran, and due to the few studies available, the disease is not considered or is confused with other febrile diseases such as malaria or influenza. Due to the zoonotic nature of the disease and the potential contamination of host animals, it is necessary for the veterinary agencies and organizations, and subdivisions of the Ministry of Health to interact extensively and closely to identify reservoirs and prevent and control the disease. Given the health and economic importance of the disease in humans and livestock, it is recommended that ruminants in the disease reservoir be identified after slaughter and that at-risk individuals such as veterinarians, ranchers, and slaughterhouse workers be vaccinated.

 

None.

 

None.
 
 

Conflicts of Interest

The authors declared no conflict of interest.