year 17, Issue 2 (March - April 2023)                   Iran J Med Microbiol 2023, 17(2): 167-175 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Salehi S, Nakhaei Moghadam M, Asgharian Rezaei Y, Najimi M, Yousefi E. Antibiotic Resistance Pattern and Prevalence of tetA, tetB, tetR, OXA-10 and OXA-48 Resistance Genes among Escherichia coli Isolates from Toilets in Mashhad Azad University (Iran) in 2020. Iran J Med Microbiol 2023; 17 (2) :167-175
URL: http://ijmm.ir/article-1-1626-en.html
1- Department of Biology, Mashhad Branch, Islamic Azad University, Mashhad, Iran
2- Department of Biology, Mashhad Branch, Islamic Azad University, Mashhad, Iran , mahboobe_nak@yahoo.com
3- Department of Cell and Molecular Biology & Microbiology, faculty of biological science and Technology, University of Isfahan, Isfahan, Iran
Full-Text [PDF 804 kb]   (1352 Downloads)     |   Abstract (HTML)  (4038 Views)
Full-Text:   (1043 Views)
Introduction


The appearance and prevalence of antimicrobial-resistance (AR) among human pathogens have been observed in recent decades and have led to the development of antibiotic-resistant bacteria (1). Microorganisms are capable of developing resistance to antibiotics, and this occurs when a bacterium acquires a resistance gene that reduces or eliminates the drug's effect, in which case the mutated gene survives. Any antimicrobial agent can cause resistance in the microbial population and thus produce resistant genes (2).
Regrettably, improper use of antimicrobial drugs kills some sensitive microorganisms and creates favorable living conditions for resistant bacteria. So the effectiveness of some antibiotics has decreased (3). In developing countries, the transmission of antibiotic-resistant bacteria often occurs person-to-person through contaminated food, drinking water, and insects. Drug resistance can mean that people infected with such bacteria do not respond to conventional antibiotic drugs (4, 5).
For the first time in 1885, Theodor Escherich, a German-Austrian pediatrician, isolated a motile gram-negative bacterium from an infant´s gut that grew well in synthetic culture media. Escherich named the bacterium coli commune, known as Escherichia coli in 1919 (6). The genus E. coli is a member of the Enterobacteriaceae family, which exists as part of the normal flora in the large intestine of humans and animals. E. coli is a gram-negative bacillus usually with mobile flagella. Each gram of human feces contains more than108 E. coli bacteria (7, 8). E. coli resistant strains can be transmitted through human, animal, and food products and can also transfer their resistance genes to other pathogens. Among antibiotic-resistant E. coli, the prevalence of tetracycline-resistant strains is high (9).
Tetracycline is not commonly used to treat E. coli infections in humans; however, resistance to this antibiotic is widespread in E. coli infections. The amino acid sequence of tetracycline pumps is divided into six groups, including tet A, tet B, tet C, tet D, and tet E, in group 1 due to amino acid similarities. Tetracycline efflux pumps are specifically involved in developing tetracycline resistance (10). Plasmids and transposons are the main factors in the rapid spread of tetracycline resistance genes among E. coli strains (9). Resistance to tetracycline in bacteria is associated with reflux, ribosomal protection, enzyme inactivation, and target modification. Tetracycline efflux was first identified in Shigella dysentery in 1953 (11).
A limited number of bacteria receive tetracycline resistance through mutations. This can happen by altering the permeability of outer membrane purines, outer membrane lipopolysaccharides, changes in ribosomal 16S rRNA component, or mutations in genes associated with the ion pump mechanism swells (3). Regarding tetracycline resistance among E. coli in clinical and animal samples and the lack of genetic sequences of this bacterium, we decided to sample from the toilets and identify the resistant genes by molecular techniques. The aim of this study was to determine antibiotic resistance pattern and prevalence of tetA, tetB, tetR, OXA-10 and OXA-48 genes among E. coli isolates from Toilets in Mashhad Azad University in Iran.


 

Materials and Methods

2-1. Collection and Identification of Isolates

This cross-sectional study involved 200 samples that were collected randomly from the toilets of faculty of Basic Sciences, Islamic Azad University in Mashhad, over three months from October to December 2020 (during the Covid-19 pandemic) and under sterile conditions, sent to the laboratory. Tests for isolation and identification of bacteria were performed up to 5 h after sampling. To separate E. coli, sterile swabs soaked in sterile distilled water then sampling was done from bathroom parts, including stones, hoses, faucets, trash cans, toilets, washbasin, handles, and floors. Twenty-four samples were taken from each part. Samples were separated from men's, women's, and employees' toilets.

2-2. Culture of Isolates

Swabs were put in the tube containing nutrient broth medium, and the tubes were incubated for 24 h at 37°C under aerobic conditions. Next, to dilute the microbial suspension, 10μl of suspension was inoculated into the surface of eosin methylene blue (EMB) agar and nutrient agar by streak culture and plates were incubated at 37°C for 24 h. In the next step, colonies were tested for gram staining and differential biochemical tests include oxidase, catalase, indole, methyl red, Voges-Proskauer test, citrate, fermentation of sugar, production of H2S and gas in Kligler's Iron (KIA) agar (12). Gram staining, catalase and coagulase test, esculin hydrolysis in bile esculin agar, fermentation of mannitol in mannitol salt agar and novobiocin test were used to identify gram-positive bacteria (12).

 2-3. Antibiotic Susceptibility Test

An antibiogram test was performed by the disk diffusion method according to the Clinical & Laboratory Standards Institute (CLSI) (13).The antibiotic resistance test was assessed in Mueller-Hinton agar for the eighth standard antibiotic discs (Padtan Teb, Iran), including Ampicillin (10μg), Tetracycline (30μg), Gentamicin (10μg), Cefixime (5μg), Cefotaxime (30μg), Ceftazidime Clavulanat (10μg), Ceftazidime (30μg) and Ciprofloxacin (5μg). After measuring the diameter of the growth inhibition zone and according to the standard table, each isolate's sensitivity and resistance status were reported. E. coli PTCC 1330 was used as a reference strain for antibiotic susceptibility testing.

2-4. DNA Extraction

For this purpose, pure colonies of E. coli isolates were inoculated in 3 mL of brain heart infusion broth and incubated at 37℃ for 18 hours. DNA extracted by using a Sinaclon DNA extraction kit for gram-negative bacteria and stored in a freezer at -20 °C. To confirm E. coli, a PCR test was performed using 16S rRNA specific primer (Table 1). E. coli PTCC 1330 was used as a positive control, and sterile distilled water was used as a negative control.

2-5. Detection of blaOXA-10, blaOXA-48, blaTEM-1, tetA, tetB, and tetR genes

Specific primers were used to differentiate strains containing beta-lactamase enzymes OXA-10, OXA-48, and TEM-1 in beta-lactam resistant isolates and to detect tetA, tetB, and tetR genes in tetracycline-resistant isolates. PCR was used to detect genes. Specific primers of blaOXA-10, blaOXA-48, blaTEM-1, and tetA were selected from the papers (as shown in Table 1) and for the tetB and tetR primers were designed using AllelID v 6.01 software (14). In order to check the specificity for the desired sequence, all the primers were blasted in the NCBI site.

Table 1. Primers used in the present research

Reference Product Size reverse sequences
(‘5→’3)
forward sequences
(5’→3’)
primer
(15) 798 GGACTACCAGGGTATCTAAT AGAGTTTGATCATGGCTCAG 16S rRNA
(16) 276 TCCCACACCAGAAAAACCAG TCAACAAATCGCCAGAGAAG OXA-10
(16) 438 CATCAAGTTCAACCCAACCG GCGTGGTTAAGGATGAACAC OXA-48
(17) 800 CGTTCATCCATAGTTGCCTGAC CATTTCCGTGTCGCCCTTATTC TEM-1
- 174 CAGGCAGGTGGATGAGGAAC GGCAGGCAGAGCAAGTAGAG tetR
- 340 GCATCGCTGGATTACTTATTG CTACTTCGGTATCTGTATTATCAC tetB
(18) 234 CTTTCTCGGTCCTTCAAC GACAATCAACTACTTCACTG tetA

The final volume of the PCR reaction (25 µL) in was as follows: 12.5 µL of Mastermix (2X) (Pars Toos, Iran), 1 µL of each forward and reverse primer (10 mM) (Sinaclon, Iran), 2 μL of DNA template (33.0 ng) and 8.5 μL of distilled water. PCR of each gene was performed using a thermocycler (Kyratec, Korea) with the time and temperature program as listed in Table 2.


Table 2. Optimal conditions for PCR of 16S rRNA, blaOXA-10, blaOXA-48, blaTEM-1, tet-A, tet-B and tet-R genes

Final extension Extension Annealing Denaturation Initial denaturation  
Time Temp Time Temp Time Temp Time Temp Time Temp  
5 min 75 45s 72 45s 51 45s 94 5 min 94 16S rRNA
5 min 75 30s 72 30s 52 30s 95 5 min 95 blaOXA-10
5 min 75 30s 72 30s 53 30s 95 5 min 95 blaOXA-48
10 min 72 60s 72 45s 57 45s 94 9 min 94 blaTEM-1
3 min 75 30s 72 30s 57 30s 94 5 min 95 tetA
5 min 75 45s 72 45s 56 45s 94 5 min 95 tetB
3 min 75 30s 72 30s 50 30s 94 5 min 95 tetR


2-6. Gene Sequencing

PCR products were electrophoresed on a 1% agarose gel containing green viewer for 60 min at a voltage of 90 volts. Finally, gel agarose and DNA bands were photographed using a gel documentation device.
The PCR products of blaOXA-10, blaOXA-48, blaTEM-1, tetA, tetB, and tetR genes were sent to the Genetics Laboratory of Razavi Hospital in Mashhad for sequencing. The obtained results were analyzed via Gene Codes Sequencher v5.4.6 software to check the sequence on NCBI website.

2-7. Statistical Analysis

SPSS Statistics V22.0 (IBM, Chicago, IL, USA) and Kolmogorov-Smirnov tests were used to perform statistical analysis and p-values of less than 0.05 (p<0.05) were considered statistically significant.

 
 

Results

Results being studied out of 200 samples collected in this study showed that 159 isolates were identified as gram-negative bacteria based on microscopic characteristics and, 41 isolates (20.5%) were identified as E. coli based on colony characteristics and biochemical tests (Figure 1).


 Figure 1. Frequency of isolated bacteria
Figure 1. Frequency of isolated bacteria

 
All gram-negative isolates with results of oxidase negative, catalase-positive, lactose positive, H2S negative, gas positive, indole positive, methyl-red positive, Voges-Proskauer negative, and citrate negative was identified as E. coli. All E. coli isolates were confirmed using 16S rRNA gene-specific primers in the PCR (Figure 2).
The antibiotic susceptibility of E. coli isolates was evaluated by the disk diffusion method. The Kolmogorov-Smirnov test among antibiotics-resistance E. coli isolates showed a significant resistant to Cefotaxime (P>0.001) (Figure 3).
Table 3 represents high resistance to Cefotaxime (74.60 %) among the isolates. E. coli isolates showed the highest sensitivity to Gentamicin (58.74 %).
 

 Figure 2. Gel electrophoresis of 16S rRNA gene for some E. coli isolates with 100bp ladder (L: Ladder, +: positive control, -: negative control)
Figure 2. Gel electrophoresis of 16S rRNA gene for some E. coli isolates with 100bp ladder (L: Ladder, +: positive control, -: negative control)


Table 3. Antibiotic susceptibility of E. coli isolates

Type of antibiotic Resistant (%) Intermediate (%) Sensitive (%) p-Value
Tetracycline 38(60.32) 10(15.87) 15(23.81)  
Cefixime 41(65.08) 6(9.52) 16(25.40)  
Ampicillin (63.49) 40 7(11.11) 16(25.40)  
Ciprofloxacin 39(61.90) 5(9.93) 18(28.17) P> 0.001
Ceftazidime 45(71.43) 5(7.94) 13(20.63)
Ceftazidime clavulanate 44(69.83) 4(6.36) 15(23.81)  
Gentamicin 14(22.22) 12(19.04) 37(58.74)  
Cefotaxime 47(74.60) 4(6.36) 12(19.04)  


Figure 3. Antibiotics susceptibility patterns of E. coli isolates (P> 0.001) 
Figure 3. Antibiotics susceptibility patterns of E. coli isolates (P> 0.001)

 

Detecting of blaTEM-1, blaOXA-10, and blaOXA-48 genes among 20 beta-lactam-resistant isolates by PCR indicated that 6 isolates (30%) had blaTEM-1 gene (Figure 4); 4 (20%) had blaOXA-10 gene (Figure 5) and 5 isolates (25%) had blaOXA-48 gene (Figure 6).
 

Figure 4. Electrophoresis gel of blaTEM-1 gene for some resistant E. coli isolates to beta-lactam antibiotic with 100bp ladder (L: Ladder, +: positive control, -: negative control)

Figure 5. Electrophoresis gel of blaOXA-10 for some resistant E. coli isolates to beta lactam antibiotic with 100bp ladder (L: Ladder, +: positive control, -: negative control)

Figure 4. Electrophoresis gel of blaTEM-1 gene for some resistant E. coli isolates to beta-lactam antibiotic with 100bp ladder (L: Ladder, +: positive control, -: negative control)

Figure 5. Electrophoresis gel of blaOXA-10 for some resistant E. coli isolates to beta lactam antibiotic with 100bp ladder (L: Ladder, +: positive control, -: negative control)

 

To detect the blaTEM-1 gene, a strain from the Microbiology Laboratory of Mashhad Azad University collection containing the desired gene was used as a positive control (19).
To detect the blaOXA-10 and blaOXA-48 genes, a strain from the Microbiology Laboratory of Mashhad Azad University collection containing the desired gene was used as a positive contrast (16).
Among 38 tetracycline-resistant isolates, (7.89%) carried the tetA (Figure 7) and 2 (5.25%) carried the tetR gene (Figure 8). The tetB gene was not detected in any tetracycline-resistant isolates.
The strains carrying tetA and tetR genes from microbial collection of the Microbiology Laboratory of Mashhad Azad University were used as positive controls (20).
 

 Figure 6. Electrophoresis gel of blaOXA-48 gene for some resistant E. coli isolates to tetracycline with 100bp ladder (L: Ladder, +: positive control, -: negative control)

Figure 7. Electrophoresis gel of tetA gene for some resistant E. coli isolates to tetracycline with 100bp ladder (L: Ladder, +: positive control, -: negative control) 

Figure 8. Electrophoresis gel of tetR gene for some resistant E. coli isolates to tetracycline with 100bp ladder (L: Ladder, +: positive control, -: negative control) 

Figure 6. Electrophoresis gel of blaOXA-48 gene for some resistant E. coli isolates to tetracycline with 100bp ladder (L: Ladder, +: positive control, -: negative control)

Figure 7. Electrophoresis gel of tetA gene for some resistant E. coli isolates to tetracycline with 100bp ladder (L: Ladder, +: positive control, -: negative control)

Figure 8. Electrophoresis gel of tetR gene for some resistant E. coli isolates to tetracycline with 100bp ladder (L: Ladder, +: positive control, -: negative control)

 

Gene Sequencing

PCR products of blaOXA-10, blaOXA-48, blaTEM-1, tetA, tetB, and tetR genes were sent for sequencing. The data were obtained from the Genetics Laboratory of Razavi Hospital in Mashhad and was BLAST on the NCBI website. The results were shown in Table 4.

 
Table 4. Accession Number of similar sequences in the NCBI database and their degree of similarity

Gene name Similar sequence Accession Number in the NCBI database Alignment
Explanation
blaOXA-10 HM240865 Nucleotide C was deleted in row 56.
blaOXA-48 MN654467 Alignment 100 %
blaTEM-1 -  
tet-A KX117210 Alignment 100 %
tet-B -  
tet-R KX117210 There is nucleotide A instead of nucleotide G in row 546.


 

Discussion

The spread of beta-lactamases among gram-negative bacteria has been reported as the most serious threat to infectious diseases. The increasing use of antibiotics has led to inherent and acquired resistance among these gram-negative microbes (21). OXA enzymes are a class of beta-lactamase enzymes that hydrolyze Oxacillin antibiotics. These enzymes are widely distributed among various strains of Enterobacteriaceae and Acinetobacter. These enzymes can also hydrolyze Carbapenem antibiotics. Given that these antibiotics are among the most beneficial ones for treating infections, resistance to these antibiotics is a significant risk (22, 23).
In this research, from 200 samples collected, 41 isolates (20.5%) were identified as E. coli. Antibiogram results showed that they had the highest resistance to Cefotaxime with 74.60% and the most heightened sensitivity to gentamicin with 58.74%. Regarding the detection of beta-lactam resistance genes, among 20 isolates, six isolates (30%) carried the blaTEM-1 gene, four isolates (20%) carried blaOXA-10 gene and five isolates (25%) carried the blaOXA-48 gene.
Also, research on the frequency of Tetracycline-resistance genes, among 38 isolates, three isolates (7.89%) had the tetA gene, and two isolates (5.26%) had the tetR gene. None of the isolates had the tetB gene. From the results of tracking tet genes in our work, it is inferred that, fortunately, the prevalence of these genes in the population study is low.
In a study in Bojnourd, out of 50 urine samples, 34 E. coli samples had resistance genes, and among them, 12 isolates (24%) had blaTEM-1 beta-lactamase. The highest frequency of antibiotic resistance was observed for Ampicillin (84%), Co-trimoxazole (60%), and the highest frequency of antibiotic susceptibility was observed, Nitrofurantoin (94%) and Gentamicin (78%) (24).
The higher frequency of the blaTEM-1 gene and the difference in antibiotic-resistance in this research compared to Amiri et al. could be due to differences in the geographical areas studied.
In another similar study by Mousavi et al. in Robat Karim (Iran), from 253 urine samples collected from patients, 100 samples were identified as E. coli (55%). Among them, 60 isolates were positive for ESBL production, of which 48 isolates with the TEM gene were reported (25).
Similar to the present work, ESBL-producing strains have a high frequency, indicating a high prevalence of beta-lactamase genes in the community; however, the frequency of TEM gene is much higher than in this study, which may be due to differences in the type of sample.
Studies in Iran, Tunisia, Sudan, Brazil, South Africa, and India have reported widespread prevalence of beta-lactamases by E. coli carrying the TEM gene, with an average of 53% indicating the high prevalence of this gene in developing countries (26-30).
Examination by Kamrani Hemmat et al., in several hospitals in different cities in Iran (Tehran, Borojerd, and Sanandaj), Out of 150 isolates of E. coli, 88 isolates (27.86%) had tetA gene, and 83 isolates (37.81%) had the gene tetB were identified. In 74 isolates (54.72%), both genes had Tetracycline resistance, and in five isolates (90.4%), they lacked resistant genes (3).
A study by Kadai et al., in Zabol City, out of 100 isolates of E. coli, 57 isolates were tetracycline resistant, of which 32 isolates (14.56%) were resistant to tetA gene, and 28 isolates (12.49%) were carriers of the tetB gene. Both tetA and tetB genes were present in 15 isolates (10).
A comparison of the results of these studies with the present study shows that the prevalence of tet genes in hospitalized patients and clinical specimens is much higher than in the samples obtained in this study. Therefore, the presence of tetracycline resistance genes is the main cause of tetracycline resistance in clinical samples not in environmental samples.
In a study by Gurung et al. in Nepal, 141 E. coli isolates were identified from 154 gram-negative isolates. Ninety-seven isolates carried beta-lactamase enzymes, of which 57 isolates (33.3%) had the OXA48 gene (31).
The results of a research by Gurung et al. are similar to the present study, and the prevalence of the blaOXA-48 gene is the same. In the academic work of Hashemi et al., the prevalence of blaOXA-10 and blaOXA-48 genes among clinical isolates of Pseudomonas aeruginosa resistant to Imipenem was 26.3% and 23.6%, respectively (16). The results of these studies were almost identical.
However, a comparison of the results of the two recent studies mentioned with the current study, it cannot be concluded that the prevalence of OXA genes is the same in clinical and environmental samples. Given that there is no information on the health status of people who have used the health services; it is possible that the isolates carrying the OXA genes belonged to people who had disease.
blaTEM-1, blaOXA-10, and blaOXA-48 genes are very common in beta-lactamase-producing (ESBL) samples in this study, the outbreak of the present genes was more frequent, and according to studies conducted in Iran and European-American countries, it shows that the prevalence of resistance to beta-lactam antibiotics is increasing. To prevent the overuse of antibiotics, doctors and health professionals are expected to be informed about the drugs through preventive training programs.


 

Conclusion

The results of this research showed that E. coli carrying antibiotic resistance genes are found in toilets and the resistance gene sequence was very similar to NCBI database. Since these bacteria can play a role in the transmission and spread of antibiotic resistance, it is recommended to reduce the possibility of transmission and spread of pathogenic bacteria as well as the growth of antibiotic-resistant strains, by observing personal hygiene and daily disinfection of toilets.

 

Acknowledgment

We would like to thank the Islamic Azad University of Mashhad and all those who helped us with this research.

 

Funding

None.
 

 

Conflicts of Interest

The authors declared no conflict of interest.
 


 

Type of Study: Original Research Article | Subject: Molecular Microbiology
Received: 2022/04/24 | Accepted: 2022/11/29 | ePublished: 2023/03/30

References
1. Belaynehe KM, Shin SW, Yoo HS. Interrelationship between tetracycline resistance determinants, phylogenetic group affiliation and carriage of class 1 integrons in commensal Escherichia coli isolates from cattle farms. BMC Vet Res. 2018;14(1):1-11. [DOI:10.1186/s12917-018-1661-3] [PMID] [PMCID]
2. Blum SE, Leitner G. Genotyping and virulence factors assessment of bovine mastitis Escherichia coli. Vet Microbiol. 2013;163(3-4):305-12. [DOI:10.1016/j.vetmic.2012.12.037] [PMID]
3. Kamrani Hemat N, Mirzaee M, Najar-peerayeh S. Prevalence of tetracycline resistance genes (tetA, tetB) and antibiotic resistance pattern in uropathogenic Escherichia coli isolates. New Cellular Mol Biotechnol j. 2017;7(25):9-18.
4. Olowe O, Idris O, Taiwo S. Prevalence of tet genes mediating tetracycline resistance in Escherichia coli clinical isolates in Osun State, Nigeria. Eur J Immunol Microbiol Immunol. 2013;3(2):135-40. [DOI:10.1556/EuJMI.3.2013.2.7] [PMID] [PMCID]
5. Taghinejad J, Barati B, Sadeghi A. A study of the drug resistance pattern of Group B Streptococcus isolated from urinary samples in the city of Salmas during the year 2015. New Cellular Mol Biotechnol j. 2018;8(30):79-84.
6. Ullmann A. Escherichia coli and the Emergence of Molecular Biology. EcoSal Plus. 2011;4(2). [DOI:10.1128/ecosalplus.1.1.2] [PMID]
7. Ruppé E. Épidémiologie des bêta-lactamases à spectre élargi: l'avènement des CTX-M. Antibiotiques. 2010;12(1):3-16. [DOI:10.1016/j.antib.2010.01.003]
8. Roshdi Maleki M, Taghinejad J, Momen Amir H. Drug susceptibility of E. coli strains isolated from patients with UTI by disc diffusion agar method in Salmas city of Iran. Health MED.1146.
9. Akya A, Gheisari H, Mohammadi G, Khodadoost M. Study of the pattern of plasmid and antibiotic resistance of Escherichia coli isolated from outpatients with urinary tract infection. Sci J Kurd Univ Med Sci. 2015;20(1):89-96.
10. Kadaei V, Rashki Ghalenoo Z. Identification and determination of tetracycline resistance genes in uropathogenic Escherichia coli isolates in Sistan. Vet Microbiol. 2019;2(1):1-9.
11. Tuckman M, Petersen PJ, Howe AY, Orlowski M, Mullen S, Chan K, et al. Occurrence of tetracycline resistance genes among Escherichia coli isolates from the phase 3 clinical trials for tigecycline. Antimicrob Agents Chemother. 2007;51(9):3205-11. [DOI:10.1128/AAC.00625-07] [PMID] [PMCID]
12. Forbes BA, Sahm DF, Weissfeld AS. Diagnostic microbiology: Mosby St Louis; 2007.
13. Satlin MJ, Lewis JS, Weinstein MP, Patel J, Humphries RM, Kahlmeter G, et al. Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing position statements on polymyxin B and colistin clinical breakpoints. Clin Infect Dis. 2020;71(9):e523-e9. [DOI:10.1093/cid/ciaa121] [PMID]
14. Li X, Jensen BB, Højberg O, Noel SJ, Canibe N. Development of a species-specific TaqMan-MGB real-time PCR assay to quantify Olsenella scatoligenes in pigs offered a chicory root-based diet. AMB Express. 2018;8(1):1-13. [DOI:10.1186/s13568-018-0627-y] [PMID] [PMCID]
15. Moldagulova N, Ayupova A, Sembayeva D, Duambekov M, Khassenova E, Nagyzbekkyzy E, et al. Data on the isolation and identification of thermotolerant microorganisms from cow manure promising for organic waste processing. Data in brief. 2020;31:105761. [DOI:10.1016/j.dib.2020.105761] [PMID] [PMCID]
16. Hashemi AB, Nakhaei Moghaddam M, Forghanifard MM, Yousefi E. Detection of blaOXA-10 and blaOXA-48 Genes in Pseudomonas aeruginosa Clinical Isolates by Multiplex PCR. J Med Microbiol Infect Dis. 2021;9(3):142-7. [DOI:10.52547/JoMMID.9.3.142]
17. Xu G, An W, Wang H, Zhang X. Prevalence and characteristics of extended-spectrum β-lactamase genes in Escherichia coli isolated from piglets with post-weaning diarrhea in Heilongjiang province, China. Front Microbiol. 2015;6:1103. [DOI:10.3389/fmicb.2015.01103] [PMID] [PMCID]
18. Møller TS, Overgaard M, Nielsen SS, Bortolaia V, Sommer MO, Guardabassi L, et al. Relation between tetR and tetA expression in tetracycline resistant Escherichia coli. BMC Microbiol. 2016;16(1):1-8. [DOI:10.1186/s12866-016-0649-z] [PMID] [PMCID]
19. Moghadam M N, MM F. Antibiotic susceptibility and multi-drug resistance of escherichia coli isolates producing CTX-M and TEM type beta-lactamases in Mashhad, Iran, in 2010. 2012.
20. Naji-Hamad M, Nakhaei-Moghaddam M. Detection of Tetracycline-Resistant Genes by Multiplex Polymerase Chain Reaction in Clinical Isolates of Klebsiella Pneumonia. J Isfahan Med Sch. 2021;39(647):815-20.
21. Chaudhary M, Payasi A. Prevalence, genotyping of Escherichia coli and Pseudomonas aeruginosa clinical isolates for Oxacillinase resistance and mapping susceptibility behaviour. J Microb Biochem Technol. 2014;6(2):63-7. [DOI:10.4172/1948-5948.1000123]
22. Bokaian M, Shahraki S, Raeisi J, Mohammadzadeh Rostami F. Prevalence of OXA-2 and OXA-10 Type ESBL among Acinetobacter Strains Isolated from Patients of Zahedan (South Eastern Iran). Med J Mashhad Univ Med Sci. 2016;59(1):26-34.
23. Hujer Kristine M, Hujer Andrea M, Hulten Edward A, Bajaksouzian S, Adams Jennifer M, Donskey Curtis J, et al. Analysis of Antibiotic Resistance Genes in Multidrug-Resistant Acinetobacter sp. Isolates from Military and Civilian Patients Treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother. 2006;50(12):4114-23. [DOI:10.1128/AAC.00778-06] [PMID] [PMCID]
24. Amiri M, Farzin H, Jamshidian-Mojaver M. Phenotypic and Genotypic Study of Antibiotic Resistance among Escherichia coli Isolates from Human Urinary Infection Cases in Bojnord Province. Avicenna J Clin Med. 2019;26(3):173-80. [DOI:10.29252/ajcm.26.3.173]
25. Mousavi P, Zaker Bostan Abad S, Mirnejad R. Detection of TEM beta-lactamase Gene in Escherichia Coli Isolated from Urinary Tract Infection of referred to the clinic boarding Robat Karim to the molecular method. N Cell Mol Biotechnol J. 2018;8(30):85-94.
26. Maurya AP, Dhar D, Basumatary MK, Paul D, Ingti B, Choudhury D, et al. Expansion of highly stable bla OXA-10 β-lactamase family within diverse host range among nosocomial isolates of Gram-negative bacilli within a tertiary referral hospital of Northeast India. BMC Res Notes. 2017;10(1):1-6. [DOI:10.1186/s13104-017-2467-2] [PMID] [PMCID]
27. Adefisoye MA, Okoh AI. Identification and antimicrobial resistance prevalence of pathogenic Escherichia coli strains from treated wastewater effluents in Eastern Cape, South Africa. MicrobiologyOpen. 2016;5(1):143-51. [DOI:10.1002/mbo3.319] [PMID] [PMCID]
28. Malik I, Elhag K, Gustaw K. Characterisation of extended-spectrum β-lactamases among multidrug resistant Enterobacteriaceae from Sudan. J Pure Appl Microbiol. 2019;13(1):8. [DOI:10.22207/JPAM.13.1.06]
29. Boroumand M, Naghmachi M, Ghatee MA. Detection of phylogenetic groups and drug resistance genes of Escherichia coli causing urinary tract infection in southwest Iran. Jundishapur J Microbiol. 2021;14(2). [DOI:10.5812/jjm.112547]
30. Badi S, Cremonesi P, Abbassi MS, Ibrahim C, Snoussi M, Bignoli G, et al. Antibiotic resistance phenotypes and virulence-associated genes in Escherichia coli isolated from animals and animal food products in Tunisia. FEMS Microbiol Lett. 2018;365(10):fny088. [DOI:10.1093/femsle/fny088] [PMID]
31. Gurung S, Kafle S, Dhungel B, Adhikari N, Shrestha UT, Adhikari B, et al. Detection of OXA-48 gene in carbapenem-resistant Escherichia coli and Klebsiella pneumoniae from urine samples. Infect Drug Resist. 2020;13:2311. [DOI:10.2147/IDR.S259967] [PMID] [PMCID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc