سال 13، شماره 1 - ( فروردین - اردیهبشت 1398 )                   جلد 13 شماره 1 صفحات 21-14 | برگشت به فهرست نسخه ها


XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Majdi M, Khazaei Koohpar Z, Nasrollahi Omran A. Investigation of Mutations of ERG11 Gene in Fluconazole Resistant Strains of Candida Albicans Isolated From Patients With Volvovaginitis in West of Mazandaran. Iran J Med Microbiol. 2019; 13 (1) :14-21
URL: http://ijmm.ir/article-1-781-fa.html
مجدی معصومه، خزائی کوهپر زینب، نصرالهی عمران آیت الله. بررسی جهش‌های ژن ERG11 در سویه‌های کاندیدا آلبیکنس مقاوم به فلوکونازول جدا‌شده از افراد مبتلا به ولوواژینیت در غرب مازندران. مجله میکروب شناسی پزشکی ایران. 1398; 13 (1) :21-14

URL: http://ijmm.ir/article-1-781-fa.html


1- گروه زیست‌شناسی سلولی و مولکولی، دانشکده علوم زیستی، واحد تنکابن، دانشگاه آزاد اسلامی، تنکابن، ایران
2- گروه زیست‌شناسی سلولی و مولکولی، دانشکده علوم زیستی، واحد تنکابن، دانشگاه آزاد اسلامی، تنکابن، ایران ، dz.khazaei@gmail.com
3- گروه قارچ‌شناسی پزشکی، واحد تنکابن، دانشگاه آزاد اسلامی، تنکابن، ایران
واژه‌های کلیدی: کاندیدا آلبیکنس، ERG11، فلوکونازول، MIC، جهش
متن کامل [PDF 949 kb]   (1292 دریافت)     |   چکیده (HTML)  (3117 مشاهده)
متن کامل:   (1606 مشاهده)
مقدمه

کاندیدا آلبیکنس (Candida albicans) یکی از مهمترین مخمرهای بیماری‌زای انسان  و رایج‌ترین گونه‌ای است که در واژن 20 تا 50 درصد از زنان سالم وجود دارد ( 2). کاندیدا یکی از فلورهای قارچی طبیعی در انسان است که می‌تواند در سطوح مخاطی و پوست کلونیزه شود و در شرایط خاص میزبان از قبیل نقص سیستم ایمنی ناشی از سرطان، پیوند اعضا، عفونت HIV و همچنین در افراد دیابتی بیماری ایجاد کند. کاندیدیازیس، عفونتی است که توسط گونه‌های کاندیدا به‌خصوص کاندیدا آلبیکنس (3) ایجاد می‌شود‌. طی دو دهۀ اخیر به دلیل استفاده وسیع از آنتی‌بیوتیک‌ها، استروئید‌ها و سایر دارو‌های سرکوبگر ایمنی، فراوانی و شدت این عفونت‌ها افزایش چشمگیری داشته ‌است ‌(4). برخی ترکیبات دارویی ضد‌قارچ همچون آزول‌ها برای درمان کاندیدیازیس ولوواژینال (vulvovaginal Candidiasis) به‌ کار می‌روند ‌(3). خانواده آزول نظیر فلوکونازول، ایتراکونازول و وریکونازول با مهار سیتوکروم P450 (Erg11p) در بیوسنتز ارگوسترول تداخل ایجاد می‌کند ‌(5). ارگوسترول یک ترکیب ضروری در غشای پلاسمایی قارچ است که در حفظ پایداری غشا و مقاومت در برابر تنش‌ها نقش دارد و نبود آن به تجزیۀ سلول منجر می‌شود (3). چندین مکانیسم مقاومت به آزول‌ها شناسایی شده که شامل افزایش بیان ERG11، کاهش تمایل Erg11p به آزول در اثر جهش در ژن کد‌کنندۀ آن، از دست‌دادن توان محبوس‌کردن آزول توسط سلول در اثر افزایش بیان ژن‌های درگیر در سیستم‌های پمپ افلاکس نظیرCDR1 ، CDR2 و MDR1 و جهش در ژن ERG3 و مهار بیوسنتز ارگوسترول است (6). آنزیم لانوسترول 14 آلفا دمتیلاز آنزیمی مهم در سنتز ارگوسترول است. این آنزیم مورد هدف فلوکونازول است که با تضعیف سنتز ارگوسترول و حذف ارگوسترول در غشای سلول قارچ آن را مهار می‌کند. لانوسترول 14 آلفا دمتیلاز با ژن ERG11 رمزگذاری می‌شود (3). جهش در ژن ERG11 منجر به کاهش تمایل آزول‌ها به محصول پروتئینی این ژن و درنتیجه ایجاد مقاومت به دارو در جدایه‌های کاندیدا آلبیکنس می­شود. در مطالعات قبلی مشخص شده است که ERG11 سه ناحیه داغ جهش­­پذیری (Hotspot Regions) مطابق با آمینو­اسیدهای 105 تا 165، 266 تا 287 و 405 تا 488 دارد که جابه‌جایی­های بازی در آنها به وفور رخ می­دهد (7). در این نواحی هم در جدایه‌های حساس و هم مقاوم به آزول‌ها جهش رخ می­دهد. مطالعات نشان دا‌ده است بین وقوع جهش­های خاص در بعضی نواحی و مقاومت به آزول‌ها ارتباط وجود دارد (8)؛ به عنوان نمونه در مطالعه White و همکاران (2002) و Wang و همکاران (2015) در جدایه­های مقاوم به فلوکونازول و در مطالعه Xiang و همکاران (2013) و Manastir و همکاران (2011) در بعضی جدایه­های حساس به فلوکونازول جهش D116E شناسایی شد (9-12).
در مطالعات مختلف صدها جهش در این ژن شناسایی شده که بسیاری از آنها در جدایه­های مقاوم گزارش شده­اند. با این حال بین بعضی جهش­ها (پلی­مورفیسم­ها) و مقاومت به دارو ارتباط معنی­داری شناسایی نشده و این گروه از جهش­ها در جدایه­های حساس نیز گزارش شده است. بنابر­این لازم است در مناطق مختلف، جهش‌ها یا پلی‌مورفیسم­های موجود در ژن ERG11 در جدایه­ های مقاوم و حساس بررسی شود و با مطالعات بیشتر از جمله مطالعات بیوانفورماتیک، بین موقعیت جهش و تغییر در فعالیت پروتئین حاصل ارتباط پیدا کرد (13). هدف از این مطالعه، شناسایی جهش­های ژن ERG11 به عنوان یکی از عوامل ایجاد­کننده مقاومت به فلوکونازول در جدایه­های کاندیدا آلبیکنس در غرب مازندران به روش PCR-sequencing بود.


 
مواد و روش‌ها

جداسازی و کشت جدایه ­های مخمر کاندیدا آلبیکنس

در این مطالعه مقطعی توصیفی که در طی سال­‌های 1394-1395 انجام گرفت، 120 نمونه از نمونه­های بالینی ترشحات واژن بیماران مشکوک به عفونت کاندیدایی واژینال مراجعه‌کننده به بیمارستان­ها و مراکز بهداشتی درمانی غرب مازندران (رامسر، تنکابن، نشتارود، سلمان‌شهر و کلارآباد) توسط متخصص زنان و زایمان بعد از گرفتن مجوز از کمیته اخلاق پزشکی دانشگاه علوم پزشکی (کد IR.GUMS.REC.1395.25) تهیه و تشخیص داده شد. نمونه­‌ها در لوله­های حاوی نرمال سالین (سرم فیزیولوژی) قرار گرفتند و سریعاً به آزمایشگاه منتقل‌ شدند. سپس در محیط کشت سابرود دکستروز آگار (Sabouraud dextrose agar) (شرکت Merck آلمان)، به همراه کلرامفنیکل کشت و به مدت 48 ساعت در دمای 37 درجه سلسیوس انکوبه شدند. در ادامه، شناسایی کاندیدا آلبیکنس بر­­ اساس مورفولوژی کلنی، تشکیل لوله زایا و تعیین رنگ کلنی­ها در محیط کروم آگار کاندیدا (شرکتCHROMagar ، فرانسه) انجام گرفت. از سویه PTCC 5027 (ATCC10231) به ‌عنوان سویه حساس و کنترل استفاده شد.

سنجش حساسیت آنتی‌بیوتیکی

به منظور تعیین الگوی حساسیت دارویی، حساسیت یا مقاومت جدایه ­ها نسبت به آنتی­بیوتیک فلوکونازول، دیسک­های داروی فلوکونازول (25 میکروگرم) (کمپانی HiMedia، هند) به روش کربی بائر (انتشار از دیسک) بررسی شد. بعد از 24 ساعت انکوباسیون در دمای 37 درجه سلسیوس، قطر هاله عدم رشد اطراف هر دیسک اندازه‌گیری و نتایج آن طبق استاندارد CLSI 2013 گزارش شد (جدول 1).

تعیین  (MIC)Minimum Inhibitory Concentration

برای تعیین حداقل غلظت بازدارندگی آنتی­بیوتیک فلوکونازول، ابتدا جدایه­ها در محیط کشت سابورو­دکستروز براث حاوی آنتی­بیوتیک کلرامفنیکل به مدت 24 ساعت کشت داده شدند. سپس رقت­های متوالی آنتی­بیوتیک فلوکونازول در محدوده غلظت 125/0-64 میکروگرم بر میلی­لیتر، همراه با کاندیدا آلبیکنس (103×0.5-0.25) و محیطRPMI در میکروپلیت 96 خانه تهیه شد. بعد از 24 ساعت کشت در دمای 37 درجه سلسیوس در انکوباتور شیکردار میزان MIC بر اساس استاندارد CLSI تعیین شد (جدول 1).

جدول 1. مقادیر MIC و قطر هاله عدم رشد استاندارد برای جدایه­های کاندیدا آلبیکنس بر اساس روش CLSI
داروی ضدقارچ غلظت آنتی­بیوتیک در هر دیسک (µgr) قطر هاله (mm) مقدار MIC (gr/ml)
S S-DD R S S-DD R
فلوکونازول µgr 10 19 18-15 14 8 23-16 64
حساس وابسته به دوزS-DD ، حساس= S ، مقاوم=R
 
جدول 2. مشخصات جفت پرایمر استفاده‌شده در واکنش PCR (14)
طول محصول PCR توالی پرایمر نام پرایمر
483 bp 5ˊ- TTAGTGTTTTATTGGATTCCTTGGTT -3ˊ ERG11-1F
5ˊ-TCTCATTTCATCACCAAATAAAGATC-3ˊ ERG11-1R
 

تخلیص DNA ژنومی

جدایه­ های کاندیدا آلبیکنس در محیط سابورود دکستروز براث (Merck ، آلمان) کشت داده و به مدت 24 ساعت در دمای 37 درجه سلسیوس انکوبه شدند. سپس تخلیص DNA به روش جوشاندن ((Boiling صورت گرفت. در ادامه برای اطمینان از صحت تخلیص، نمونه‌های DNA در ژل آگارز 5/1 درصد الکتروفورز و بررسی شد.
 

واکنش PCR و تعیین ­توالی ژن ERG11

بعد از تخلیص DNA ژنومی، اجزای واکنش PCR با استفاده از کیت AccuPower Pfu PCR PreMix) شرکت تکاپوزیست) در حجم نهایی 30 میکرولیتر با افزودن DNA ژنومی (3 میکرولیتر) و جفت پرایمر( 20 پیکو مول) (هر کدام 1میکرولیتر) به مستر میکس (حاوی آنزیم، کوفاکتور و بافر مخصوص در حجم 5 میکرولیتر) و 20 میکرولیتر از آب دیونیزه آماده شد. شرکت Bioneer (کره جنوبی) سنتز پرایمرها (14) را انجام داد (جدول 2). واکنش PCR با استفاده از ترموسایکلر (TUCH ، آمریکا) طبق برنامه زیر انجام شد: یک مرحله واسرشت‌شدن ابتدایی در 94 درجه سلسیوس به مدت 4 دقیقه، 35 سیکل به ترتیب در دمای 94 درجه سلسیوس به مدت 45 ثانیه، 56 درجه سلسیوس به مدت 45 ثانیه و 72 درجه سلسیوس به مدت 2 دقیقه و یک مرحله گسترش نهایی در دمای 72 درجه سلسیوس به مدت 10 دقیقه.
بعد از اطمینان از تک­باند بودن محصولات PCR، نمونه­ ها با حفظ زنجیرۀ سرمایی توسط شرکت تکاپو­زیست (ایران، تهران) به شرکت Bioneer کره جنوبی ارسال شد. نمونه‌ها توسط شرکت Bioneer تعیین ­توالی شد. سپس نتایج حاصل از توالی­ یابی به کمک نرمافزار CLC main workbench v3.5 و نرمافزار آنلاین بلاست (BLAST) از نظر وجود جهش در نمونه­ های مقاوم در مقایسه با نمونه استاندارد رفرنس موجود در سایت NCBI بررسی شد.

یافته‌ها

در این مطالعه مقطعی از زنان در محدودۀ سنی 20 تا 45 سال که حدود 60 درصد از آنها کاندیدیازیس عودکننده داشتند نمونه‌گیری شد. از بین 50 نمونه کاندیدای شناسایی­شده در این تحقیق، با تست های تشخیصی از جمله کشت در محیط کروم آگار 45 نمونه کاندیدا آلبیکنس و 5 نمونه کاندیدا کروزویی گزارش شد. از بین 45 جدایه کاندیدا آلبیکنس شناسایی­شده، به روش انتشار از دیسک 4۰ نمونه (89 درصد) مقاوم و 5 نمونه (11 درصد) حساس به فلوکونازول گزارش شد. همچنین حداقل غلظت مهار­کنندگی دارو (MIC) به روش براث دایلوشن برای نمونه­های حساس و مقاوم تعیین شد. نتایج MIC، نتایج روش انتشار از دیسک را تأیید کرد. نمونه‌های حساس به روش انتشار دیسک MIC بین 2 تا 8 میکروگرم در میلی‌لیتر و همۀ جدایه‌های مقاوم MIC 64 میکروگرم بر میلی‌لیتر داشتند.

جهش ­های ژن ERG11 در جدایه­ های مقاوم به فلوکونازول

بعد از انجام واکنش PCR (شکل 1)، بر اساس نتایج تعیین­توالی (جدول 3) در 18 جدایه جهش­های خاموش شناسایی شد. در شش جدایه جهش بدمعنی D116E به صورت هتروزایگوت گزارش شد که در کدون M-116، آسپارتیک اسید به گلوتامیک اسید تبدیل شده بود (شکل 2). همچنین در یک جدایه مقاوم جهش بدمعنی K128T به صورت هتروزایگوت بود که در کدون M-128، لایزین به تیروزین تبدیل شده بود (شکل 3). در یک جدایه مقاوم نیز جهش بدمعنی A114S به صورت هموزایگوت گزارش شد که در کدون M-114، آلانین به سرین تبدیل شده بود (شکل 4).   
 
    
شکل 1. محصولات PCR در ژل آگارز 5/1 درصد. ستون 1: DNA مارکر 100جفت بازی، ستون­های 2 تا 10: محصولات PCR مربوط به جفت پرایمر 1 با طول 483 جفت باز

 
جدول 3. تغییرات بازی و آمینواسیدی ایجادشده در ژن ERG11 در جدایه­های کاندیدا آلبیکنس مقاوم به فلوکونازول
تغییر آمینواسیدی تغییر بازی تعداد جدایه­های دارای جهش (درصد)
F72F TTC(Phe)>TTT(Phe) 6 (15)
F105F TTT(Phe )>TTC(Phe) 18 (45)
A114S GCT(Ala )>TCT(Ser) 1 (2/5)
D116E GAT(Asp)>GAA(Glu) 6 (15)
K119K AAA(Lys )>AAG(Lys) 6 (15)
K128T AAA(Lys )>ACA(Thr) 1 (2/5)
S137S TCC(Ser)>TCA(Ser) 18 (45)
L161L AAG(Lys )>AAA(Lys) 1 (2/5)
H183H CAT(His )>CAC(His) 11 (27)
 
 


شکل 2. الکتروفروگرام مربوط به تغییر باز T به A در کدون 116 با تغییر کدونی GAT(Asp)>GAA(Glu)) و تغییر آمینو­اسیدی D116E




شکل 3. الکتروفروگرام مربوط به تغییر باز A به C در کدون 128 با تغییر کدونی AAA(Lys )>ACA(Thr)) و تغییر آمینو­اسیدی K128T
 



شکل 4. الکتروفروگرام مربوط به تغییر باز G به T در کدون 114 با تغییر کدونی GCT(Ala )>TCT(Ser) و تغییر آمینو­­اسیدی A114S

 
بحث

کاندیدا پاتوژن فرصت­طلبی است که قادر به ایجاد بیماری در افراد دارای نقص ایمنی و یا ایمنی تضعیف­شده است. کاندیدیازیس عفونتی است که توسط گونه­های مختلف کاندیدایی، به‌خصوص کاندیدا آلبیکنس، ایجاد می­شود (8). فلوکونازول یکی از دارو­های اصلی ضد­قارچ درمان عفونت­های کاندیدیایی (کاندیدیازیس) است (12). در این مطالعه برای اولین بار در غرب مازندران جهش در ژن ERG11، یکی از مهم­ترین علل ایجاد مقاومت به فلوکونازول در زنان دچار ولوواژینیت، بررسی و سه جهش D116E، K128T و A114S در جدایه­های مقاوم به این دارو شناسایی شد.
در مطالعه Xu و همکاران در سال 2008 بر روی 426 ایزوله جمع ­آوری ­شده از بیماران غیر­ایدزی که 68/6 درصد از موارد کاندیدا آلبیکنس بودند تنها 5/1 درصد مقاوم به فلوکونازول بود (14). در مطالعۀ Wang و همکاران در سال 2015 مشخص شد که در بین 302 جدایۀ کاندیدا آلبیکنس حدود 8/5 درصد موارد مقاوم به فلوکونازول بودند (10). در مطالعه Ungureanu و همکاران در سال‌های 2014 تا 2015 بر روی 4027 بیمار، 625 جدایه کاندیدا آلبیکنس همگی مقاوم به فلوکونازول (100 درصد) و همگی حساس به کلوتریمازول و کتوکونازول بودند (15). در مطالعه Farahbakhsh و همکاران در سال 2012 مشخص شد که 28/7 درصد جدایه­ های حاصل از کاندیدیازیس دهانی در مبتلایان به HIV مقاوم به فلوکونازول هستند (16). در مطالعۀ Nasrollahi
Omran و همکاران در سال 2015 بر روی 46 جدایه کاندیدا آلبیکنس، 14 جدایه (0/30) مقاوم به فلوکونازول شناسایی شد (17). در مطالعۀ Mohammadi-Ghalehbin و همکاران در شهر اردبیل در سال 2017 از 118 کاندیدا آلبیکنس جدا­شده از زنان باردار، مقاومت به فلوکونازول در 97 جدایه (0/82) گزارش شد (18). در مطالعه Balabandi و همکاران در سال های 2015 و 2016 از 23 جدایه کاندیدا آلبیکنس جداشده از زنان دچار ولوواژینیت در شهر رشت، 20 جدایه (0/87) به فلوکونازول مقاوم بودند (8).
بر اساس تحقیقات صورت‌گرفته موضع عفونت کاندیدیایی و شیوع آن در هر منطقه جغرافیایی و همچنین مصرف نادرست دارو باعث شده است نرخ متفاوتی از مقاومت به فلوکونازول در کشور و دیگر نقاط جهان گزارش شود. با این حال نتایج مطالعه حاضر نشان­دهنده نرخ بالای مقاومت به این دارو در مبتلایان به کاندیدیازیس واژینال در استان مازندران است. در مطالعات Xu در سال 2008 و Wang در سال 2015 هر دو در چین درصد مقاومت کمتر از 10 درصد مشاهده شد. ممکن است درصد کم مقاومت به این دارو در این کشور به ­دلیل استفاده صحیح از آنتی‌بیوتیک­ها و یا استفاده‌نکردن از این گروه از آنتی­بیوتیک­ها باشد که طی 7 سال افزایش چندانی در مقاومت به دارو ایجاد نشده است. همچنین در مطالعات Nasrollahi Omran در مازندران و Farahbakhsh در تهران به ترتیب در سال­های 2015 و 2012 فراوانی مشابهی از مقاومت به دارو مشاهده شده بود. که در مطالعات جدیدتر (Mohammadi-Ghalehbin و Balabandi) افزایش مقاومت به دارو مشاهده شد. این امر ممکن است به دلایل مختلف از جمله مصرف نادرست و بی‌رویه این دارو و ایجاد جهش‌های مختلف در سویه ­ها رخ داده باشد. در تأیید این موضوع مطالعه Ungureanu (2016) در رومانی نیز مقاومت بالایی نشان داده است که نشان می‌دهد در بعضی کشورها یا مناطق افزایش مقاومت به این دارو همچنان از مشکلات مهم محسوب می‌شود و لازم است در مراکز بهداشتی و درمانی استان و همچنین کشور برای درمان این گروه از عفونت­ها راهکار­های مناسب­تری لحاظ شود.
 در ایجاد مقاومت به آزول­ها مکانیسم­های مختلفی نقش دارند. آزول­ها با اتصال اتم N خود به گروه هم موجود در Erg11p و اشغال جایگاه اتصال سوبسترا باعث مهار فعالیت سیتوکروم P450 می­شوند. جهش در ERG11می­تواند با تغییرات ساختاری، تمایل آزول­ها را به این پروتئین کاهش دهد (12). تغییرات ساختاری در Erg11p نتیجه جهش­هایی است که در نواحی خاصی از ژن ERG11 به نام نقاط داغ رخ می­دهد. نرخ جهش­پذیری بالا در این نواحی نشان‌دهنده اهمیت این نواحی در عملکرد یا ساختار صحیح پروتئین است (13). در این مطالعه از جدایه­های مقاوم به فلوکونازول در 15 درصد جدایه‌ها، جهش در کدون 116 (D116E) در ژن ERG11 مشاهده شد. همچنین در 5/2 درصد جدایه ­ها جهش در کدون 114 (A114S) و 2/5 درصد جدایه ­ها جهش در کدون 128 (K128T) در ژن ERG11 مشاهده شد. این جهش ­ها در اولین نقاط داغ جهش‌پذیر در ژن ERG11 رخ داده است.
در مطالعه Xiang و همکاران در 2013، از جدایه ­های مقاوم و نیمه‌حساس به فلوکونازول جهش‌هایD116E ، A114S و K128T شناسایی شد که در رابطه با مقاومت ارتباط معناداری نداشت (10).
در مطالعۀ Xu و همکاران در سال 2008، درصد بالایی از جدایه ­های مقاوم به فلوکونازول جهش D116E، A114S و K128T داشتند که با درصد کمتری در مطالعه حاضر تطابق دارد (11). درمطالعۀRosana وهمکاراندرسال 2015،ششجابه‌جاییدرژن ERG11 از جمله D116E شناسایی شد(19). در مطالعه Perea و همکاران در سال 2001، هر دو جدایه­های مقاوم و حساس به فلوکونازول دارای جهش­های D116E و K128Tبودند که در مطالعه حاضر فقط در نمونه­های مقاوم این دو جهش دیده شد (20). بر اساس مطالعات مختلف به نظر می­رسد این جهش­ها به‌تنهایی قادر به تغییر ساختار ERG11p نیستند و همراهی جهش در دیگر نواحی با این جهش­ها می‌تواند باعث تغییر ساختار ERG11p، کاهش تمایل آن به داروهای آزولی و در نتیجه ایجاد مقاومت به آزول­ها شود.
همچنین میزان بالا MIC تعیین‌شده برای جدایه­ های مقاوم به فلوکونازول در این مطالعه نشان­دهنده وجود چندین عامل تشدیدکننده مقاومت به این دارو در این جدایه ­ها است. به طوری که در مطالعۀ Perea و همکاران، MIC64 میکروگرم بر میلی­لیتر برای فلوکونازول در جدایه­های کاندیدا آلبیکنس تعیین شد. در این جدایه­ها علاوه بر جهش­ های نقطه­ای ERG11، افزایش سطح بیان ژن­های کدکننده لانوسترول 14 آلفا دمتیلاز (ERG11) و پمپ­های انتشار ( CDR و MDR) نیز گزارش شد (20). در مطالعه حاضر میزان MIC فلوکونازول تا غلظت 64 میکروگرم بر میلیلیتر گزارش شد که نشان­دهندۀ افزایش غلظت بی­اثر فلوکونازول در نمونه‌های کاندیدا آلبیکنس جدا­شده از زنان مبتلا به ولوواژینیت در غرب مازندران است. این امر می­تواند به دلیل مصرف بی­رویه و نادرست دارو در زمان ابتلا به این عفونت و همچنین ایجاد انواع جهش­های القاکننده مقاومت به این دارو از جمله در ژن ERG11 و افزایش بیان چندین ژن چون ERG11، CDR1 ، CDR2و MDR1 باشد که به مطالعات بیشتری در این زمینه نیازمند است.


 
بحث و نتیجهگیری

در این مطالعه نرخ بالای مقاومت به فلوکونازول در جدایه­های کاندیدا آلبیکنس به همراه جهش­های D116E، K128T و A114S در ژن ERG11 مشاهده شد. بنابراین همراهی این جهش‌ها با مقاومت تنها علت افزایش مقاومت در استان نیست و به مطالعات بیشتری در این زمینه از جمله بررسی بیان ژن‌هایی چون ERG11، CDR1، CDR2 و MDR1 در جدایه­های مقاوم در استان نیاز است.

 
سپاسگزاری

این مقالۀ تحقیقاتی حاصل پایان‌نامه دانشجوی کارشناسی ارشد علوم سلولی و مولکولی است. نویسندگان مقاله از تمام کسانی که در انجام این پژوهش همکاری صمیمانه داشته­اند سپاسگزاری می‌کنند.

 
تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.





 
نوع مطالعه: مقاله پژوهشی | موضوع مقاله: میکروب شناسی مولکولی
دریافت: 1396/8/1 | پذیرش: 1398/2/26 | انتشار الکترونیک: 1398/4/31

فهرست منابع
1. Gavanji S, Larki B. Comparative Effect of Propolis of Honey Bee and Some Herbal Extracts on Candida Albicans. Chinese Journal of Integrative Medicine. 2017; 23(3):201-7. [DOI:10.1007/s11655-015-2074-9] [PMID]
2. Kabir MA, Hussain MA, Ahmad Z. Candida Albicans: A Model Organism for Studying Fungal Pathogens. ISRN Microbiology. 2012; 2012:538694. [DOI:10.5402/2012/538694] [PMID] [PMCID]
3. Pam VK, Akpan JU, Oduyebo OO, Nwaokorie FO, Fowora MA, Oladele RO, et al. Fluconazole Susceptibility and Erg11 Gene Expression in Vaginal Candida Species Isolated From Lagos Nigeria. International Journal of Molecular Epidemiology and Genetics. 2012;3(1):84-90.
4. Reiss E, Tanaka K, Bruker G, Chazalet V, Coleman D, Debeaupuis JP, et al. Molecular Diagnosis and Epidemiology of Fungal Infections. Medical Mycology. 1998; 36(Suppl 1):249-57.
5. Sanglard D, Ischer F, Parkinson T, Falconer D, Bille J. Candida Albicans Mutations in the Ergosterol Biosynthetic Pathway and Resistance to Several Antifungal Agents. Antimicrobial Agents and Chemotherapy. 2003; 47(8):2404-12. [DOI:10.1128/AAC.47.8.2404-2412.2003] [PMID] [PMCID]
6. Cernicka J, Subik J. Resistance Mechanisms in Fluconazole-Resistant Candida Albicans Isolates From Vaginal Candidiasis. International Journal of Antimicrobial Agents. 2006; 27(5):403-8. [DOI:10.1016/j.ijantimicag.2005.12.005] [PMID]
7. Flowers SA, Colon B, Whaley SG, Schuler MA, Rogers PD. Contribution of Clinically Derived Mutations in Erg11 to Azole Resistance in Candida Albicans. Antimicrobial Agents and Chemotherapy. 2015; 59(1):450-60. [DOI:10.1128/AAC.03470-14] [PMID] [PMCID]
8. Balabandi S, Khazaei -Koohpar Z, Ranji N. Correlation Between Erg11 Gene Mutations and Fluconazole Resistance in Candida Albicans Strains Isolates Isolated in From Rasht in 2015-2016 Years. Arak Medical University Journal. 2017; 20(7):13-22.
9. White TC, Holleman S, Dy F, Mirels LF, Stevens DA. Resistance Mechanisms in Clinical Isolates of Candida Albicans. Antimicrobial Agents and Chemotherapy. 2002; 46(6):1704-13. [DOI:10.1128/AAC.46.6.1704-1713.2002] [PMID] [PMCID]
10. Wang B, Huang LH, Zhao JX, Wei M, Fang H, Wang DY, et al. ERG11 Mutations Associated With Azole Resistance in Candida Albicans Isolates From Vulvovaginal Candidosis Patients. Asian Pacific Journal of Tropical Biomedicine. 2015; 5(11):909-14. [DOI:10.1016/j.apjtb.2015.08.002]
11. Xiang MJ, Liu JY, Ni PH, Wang S, Shi C, Wei B, et al. Erg11 Mutations Associated With Azole Resistance in Clinical Isolates of Candida Albicans. FEMS Yeast Research. 2013; 13(4):386-93. [DOI:10.1111/1567-1364.12042] [PMID]
12. Manastir L, Ergon MC, Yucesoy M. Investigation of Mutations in Erg11 Gene of Fluconazole Resistant Candida Albicans Isolates From Turkish Hospitals. Mycoses. 2011; 54(2):99-104. [DOI:10.1111/j.1439-0507.2009.01766.x] [PMID]
13. Debnath S, Addya S. Structural Basis for Heterogeneous Phenotype of ERG11 Dependent Azole Resistance in C.Albicans Clinical Isolates. SpringerPlus. 2014; 3:660. [DOI:10.1186/2193-1801-3-660] [PMID] [PMCID]
14. Xu Y, Chen L, Li C. Susceptibility of Clinical Isolates of Candida Species to Fluconazole and Detection of Candida Albicans ERG11 Mutations. The Journal of Antimicrobial Chemotherapy. 2008; 61(4):798-804. [DOI:10.1093/jac/dkn015] [PMID]
15. Ungureanu A, Gaman AE, Turculeanu A, Mitroi M, Drocas AI, Dobritoiu M, et al. Incidence and Antifungal Susceptibility of Candida Albicans Infections. Current Health Sciences Journal. 2016; 42(2):164-8.
16. Farahbakhsh E, Yadegari MH, Rajabi Bazl M, Taghizadeh Armaki M, Katiraee F. Identification of Fluconazole Resistance Gene Erg11 in Clinical Candida Albicans Samples Isolated From Hiv-Infected Patients by Reverse Polymerase Chain Reaction (RT-PCR). Daneshvar. 2012; 19(96):19-28.
17. Nasrollahi Omran A, Nazemi A, Kihanian S, Aryana N. Lipase Gene Expression of Resistant and Sensitive Candida Albicans to Fluconazole Isolated From Patients Suffering From Oral Candidiasis and Vaginal Candidiasis. Medical Laboratory Journal. 2015; 8(5):90-96.
18. Mohammadi-Ghalehbin B, Javanpour Heravi H, Arzanlou M, Sarvi M. Prevalence and Antibiotic Resistance Pattern of Candida spp; Isolated From Pregnant Women Referred to Health Centers in Ardabil, Iran. Journal of Ardabil University of Medical Sciences. 2017; 16(4):409-421.
19. Rosana Y, Yasmon A, Lestari DC. Overexpression and Mutation as a Genetic Mechanism of Fluconazole Resistance in Candida Albicans Isolated From Human Immunodeficiency Virus Patients in Indonesia. Journal of Medical Microbiology. 2015; 64(9):1046-1052. [DOI:10.1099/jmm.0.000123] [PMID]
20. Perea S, Lopez-Ribot JL, Kirkpatrick WR, McAtee RK, Santillan RA, Martinez M, et al. Prevalence of Molecular Mechanisms of Resistance to Azole Antifungal Agents in Candida Albicans Strains Displaying High-Level Fluconazole Resistance Isolated From Human Immunodeficiency Virus-Infected Patients. Antimicrobial Agents and Chemotherapy. 2001; 45(10):2676-2684. [DOI:10.1128/AAC.45.10.2676-2684.2001] [PMID] [PMCID]

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

ارسال پیام به نویسنده مسئول


بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله میکروب شناسی پزشکی ایران می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق   ناشر: موسسه فرنام

© 2022 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb Publishr: Farname Inc.