year 18, Issue 5 (September - October 2024)                   Iran J Med Microbiol 2024, 18(5): 319-328 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Shafigh M, Izadi Amoli R, Pournajaf A, Yahyapour Y, Kaboosi H. The Relation Between Biofilm Formation and Alginate Production in Pseudomonas aeruginosa; An Important and Neglected Topic. Iran J Med Microbiol 2024; 18 (5) :319-328
URL: http://ijmm.ir/article-1-2474-en.html
1- Department of Microbiology, Ayatollah Amoli Branch, Islamic Azad University, Amol, Iran
2- Infectious Disease and Tropical Medicine Research Center, Health Research institute, Babol University of Medical Sciences, Babol, Iran , abazar_pournajaf@yahoo.com
3- Infectious Disease and Tropical Medicine Research Center, Health Research institute, Babol University of Medical Sciences, Babol, Iran
Full-Text [PDF 554 kb]   (723 Downloads)     |   Abstract (HTML)  (2059 Views)
Full-Text:   (570 Views)
Introduction


Pseudomonas aeruginosa (P. aeruginosa) is a gram-negative flagellated bacterium that is considered as a main challenge in therapeutic failure, long-stay hospitalization, and imposing the cost burden on the health system (1, 2). This bacterium is one of the causative agents for the serious infections, particularly in immunosuppressed cases such as cystic fibrosis, cancer, intensive care units (ICU), burns and wounds (3). Todays, the appearance of multidrug resistant (MDR) isolates has become one of the most important complications in the treatment of these infections worldwide (4). Drug resistance and biofilm formation are important factors of survival and colonization of this bacterium (5).
Biofilm is a community of bacteria that is surrounded by an exopolysaccharide matrix (EPS), which acts as a supportive consortium. Extracellular polymeric substance (EPS) extracellular DNA (eDNA), and proteins are the main components of biofilm (6, 7). The pslA and pelA genes play an important role in biofilm formation as these elements showed overexpression in the biofilm-producing strains (8). The PelA and PslA play essential role in the production of carbohydrate-rich structure of the biofilm matrix (9).
Alginate is a linear un-branched polymer encoded by algD, algU, and algL genes, composed of 1–4 linked saccharides β-D mannuronic acid and a C-5 epimer of a-L-guluronic acid (10). The algU plays an effective role in the expression of the ppyR gene (putative transmembrane protein) (11). Alginate lyase (AlgL) is an enzymatic and structural protein that plays a role as a component of the alginate transporter system.
Studies have reported that resistance was significantly higher in biofilm-producing strains (12). Hentzer et al (10) declared that the high production of alginate affects biofilm development on an abiotic surface. Biofilms produced by an alginate-overproducing isolate display a highly organized architecture and are significantly more resistant to the antimicrobials than a biofilm formed by an isogenic non-mucoid organism (10). As a result, biofilm-related diseases are more difficult to eradicate and more prone to recurrence (13). Abidi et al (14) concluded that biofilm formation is significantly higher in MDR strains.
In this study, we examined the relationship between antibiotic resistance profile, alginate production, and biofilm formation in the P. aeruginosa clinical strains isolated from two tertiary therapeutic hospitals in Babol, north of Iran.


 

Materials and Methods
2.1. Ethics Declaration
This cross-sectional study was approved by the Ethics Committee of Babol University of Medical Sciences (code number IR.IAU.AMOL.REC.1401.064).
2.2. Sample Collection and Bacterial Identification
The sample size was calculated by the formula (15); n= z2P (1- P)/d2, “n” is the number of sample size, “P” is the esti­mated prevalence proportion ratios (PPR) (0.45), “z” is the probability (0.975), and “d” was the standard error of prediction (SEP) (0.05). Thus, in a period of one year (April 2022 to March 2023), in total 90 non-duplicative P. aeruginosa was collected from two large hospitals in Babol, north of Iran.
Pseudomonas aeruginosa strains were identified using colony morphology, Gram staining, oxidase and catalase tests, pyocyanin pigment, growth at 44°C, and oxidative-fermentative (OF) test, and then confirmed by the species-specific primers to amplify oprL gene with 504 bp (16). All strains were stocked in 20% v/v glycerol-tryptic soy broth (Becton Dickinson, Franklin Lakes, NJ) at -70°C for further use. P. aeruginosa ATCC 27853 and 8821M were used as quality controls.
2.3. Antimicrobial Susceptibility Testing (AST)
Kirby-Bauer disk diffusion susceptibility test was performed in agreement with the clinical and laboratory standards institute guideline (CLSI; M100-S14), on the Mueller-Hinton agar (MHA) (Merck, Darmstadt, Germany) for ciprofloxacin (CIP, 5µg, S; ≥25 mm, I; 19-24 mm, R; ≤ 18 mm), ceftazidime (CAZ, 30µg, S; ≥18 mm, I; 15-17 mm, R; ≤ 14 mm), cefotaxime (CTX, 30µg, S; ≥18 mm, I; 15-17 mm, R; ≤ 14 mm), tetracycline (TET, 30µg, S; ≥15 mm, I; 12-14 mm, R; ≤ 11 mm), imipenem (IPM, 10µg, S; ≥16 mm, I; 16-18 mm, R; ≤ 15 mm), ampicillin (AMP, 10µg, S; ≥17 mm, I; 14-16 mm, R; ≤ 15 mm), cefepime (FEP, 30µg, S; ≥18 mm, I; 15-17 mm, R; ≤ 14 mm), aztreonam (ATM, 30µg, S; ≥22 mm, I; 16-21 mm, R; ≤ 15 mm), amikacin (AN, 30µg, S; ≥17 mm, I; 15-16 mm, R; ≤ 14 mm), gentamicin (GM, 10µg, S; ≥15 mm, I; 13-14 mm, R; ≤ 12 mm), and trimethoprim-sulfamethoxazole (SXT, 5µg, S; ≥16 mm, I; 11-15 mm, R; ≤ 10 mm) (Padtan Teb Co, Iran) (17).
2.4. Alginate Production Assay
Alginate production level was determined using the carbazole method. In brief, each isolate was cultured in Luria–Bertani (LB) broth with aeration at 37˚C for 24 hr and then centrifuged for 30 min at 13,500 ×g. For alginate precipitation, the supernatant was mixed with cold 95% ethanol and then centrifuged at 13,500 × g for 13 min. Then, 70 ml of alginate solution was mixed with 600 ml of borate–sulfuric acid (24.74 gr of H3BO3 in 45 ml of 4 M KOH that was diluted in 100 ml distilled water) and 20 ml of 0.1% (w/v) carbazole (Sigma-Aldrich, St. Louis, Missouri, United States). For the chromogenic reaction, the mixture was heated at 50°C for 30 min. Finally, the optical density was recorded at 540 nm. The alginate standard curve was plotted and the amount of produced alginate was recorded per mg cell dry weight (16).
2.5. Biofilm Formation Assay
A 96-well flat-bottom microtiter plate was used for the biofilm production evaluation. Briefly, 200 μl of fresh bacterial culture in the brain heart infusion (BHI) broth was poured to the wells. Following incubation for 24 hr at 37°C, each well was washed twice with phosphate buffer saline (PBS, pH 7.2) to remove detached, frail attached, and floating 'planktonic' strains. The plate was shaken to eliminate all non-adherent isolates, and dried at the 25ºC for fixing the attached ones. The staining was done using crystal violet 0.1% (Sigma, St Louis, USA) for 6 min at room temperature, washed by tap water and allowed to dry. The optical density (OD570nm) was recorded using a microplate ELISA reader (BioTek, Bad Friedrichshall, Germany). All tests were done in triplicate and cut-off value (ODc) was determined. Biofilm formation values were measured as follows: non- biofilm forming (ODt < ODc), weakly (ODc < ODt < 2x ODc), moderately (2x ODc < ODt < 4xODc) and strongly (ODt ≥ 4xODc) (13).
2.6. Genomic DNA Extraction
Bacterial cells were lysed as follows: four to five microbial pure colonies were suspended in 25 µl of 0.25% sodium dodecyl sulfate (SDS)–0.05 N NaOH solutions and heated for 15 min. Then, 200 µl of ddH2O was added to the microtube, and 5 µl of diluted mixture was used in PCR. The quality of the extracted DNA was checked by electrophoresis on 1.0% agarose gel, while the purity and concentration was assessed at OD260/280nm (Thermo Scientific Nanodrop 2000 Spectrophotometer). Template DNA was kept at -20°C for further analysis.
2.7. Polymerase Chain Reaction
PCR was carried out in total volume of 12 μl mixture, which included 1.3 µL of template DNA, 5 µL of pre-made master-mix (Ampliqon, Stenhuggervej, Denmark), 5.2 µL of DNase-free ddH2O and 0.3 µL of each primer (at concentration of 10 pmolµL-1). The primer sequences and time-thermal condition are listed in Table 1. PCR amplicon products (4 µl) were loaded on 1.5% agarose gel prepared in 1X TBE (Tris/Borate/EDTA) buffer stained with SafeStain loading dye (CinnaGen Co., Iran) and imaged with Ultraviolet Illumination (Bio-rad, Hercules, USA).


Table 1. Oligonucleotide primer sequences and time-thermal condition used in this study (16, 18).

Target site Primer sequences Product size (bp) Time-thermal PCR condition
oprL F=5'-ATGGAAATGCTGAAATTCGGC-3'
R=5'-CTTCTTCAGCTCGACGCGACG-3'
504 Initial denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 60 s for 30 cycles and a final extension at 72°C for 10 min.
pslA F=5ʹ- TCCCTACCTCAGCAGCAAGC -3ʹ
F=5ʹ- TGTTGTAGCCGTAGCGTTTCTG -3ʹ
656 Initial denaturation at 95°C for 6 min, denaturation at 95°C for 40 s, annealing at 57°C for 30 s, extension at 72°C for 60 s for 35 cycles and a final extension at 72°C for 10 min.
pelA F=5ʹ- CATACCTTCAGCCATCCGTTCTTC -3ʹ
F=5ʹ- CGCATTCGCCGCACTCAG -3ʹ
786 Initial denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 60 s for 32 cycles and a final extension at 72°C for 7 min.
ppyR F=5ʹ- CGTGATCGCCGCCTATTTCC -3ʹ
F=5ʹ- ACAGCAGACCTCCCAACCG -3ʹ
160 Initial denaturation at 95°C for 7 min, denaturation at 95°C for 35 s, annealing at 57°C for 40 s, extension at 72°C for 60 s for 33 cycles and a final extension at 72°C for 6 min.
algD F:5’-AGAAGTCCGAACGCCACACC-3’
R:5’-CGCATCAACGAACCGAGCATC-3’
550 Initial denaturation at 95°C for 5 min, denaturation at 95°C for 55 s, annealing at 58°C for 45 s, extension at 72°C for 60 s for 32 cycles and a final extension at 72°C for 6 min.
algU F=5ʹ- CGATGTGACCGCAGAGGATG-3ʹ
F=5ʹ- TCAGGCTTCTCGCAACAAAGG-3ʹ
292 Initial denaturation at 95°C for 7 min, denaturation at 95°C for 45 s, annealing at 57°C for 35 s, extension at 72°C for 60 s for 30 cycles and a final extension at 72°C for 6 min.
algL F: 5ʹ-CCGCTCGCAGATCAAGGACATC-3ʹ
R: 5ʹ-TCGCTCACCGCCCAGTCG-3ʹ
432 Initial denaturation at 95°C for 6 min, denaturation at 95°C for 50 s, annealing at 58°C for 40 s, extension at 72°C for 55 s for 33 cycles and a final extension at 72°C for 8 min.


 

Results

Totally, 90 P. aeruginosa strains were obtained from 56.7% (n=51) male cases. The age range of the patients was from 18 to 89, with the mean age of 42.2 ± 1.3 years. The origin of samples was urine (n=21/90, 23.3%), wound (n=19/90, 21.1%), bronchoalveolar lavage (n=19/90, 21.1%), blood (n=11/90, 12.2%), sputum (n=9/90, 10.0%), stool (n=9/90, 10.0%), and cerebrospinal fluid (CSF) (n=2/90, 2.2%). The prevalence of strains according to the wards was as follows: intensive care unit [ICU] (n=23/90, 15.5%), infectious disease (n=20/90, 14.4%), neonatal intensive care unit [NICU] (n=16/90, 13.3%), emergency (n=16/90, 11/1%), internal medicine (n=10/90, 11.1%), surgery (n=3/90, 8.9%) and hematology-oncology (n=2/90, 3.4%).
As shown in Table 2, the highest resistance rate was related to CAZ (n=67/90, 74.4%), followed by ATM (n=57/90; 63.3%), FEP (n=49/90, 54.4%), TET (n=45/90, 50.0%) and CIP (n=33/90, 36.7%). Resistance to IPM showed that the frequency of carbapenem-resistant strains (CRPA) was 63.3% (n=57/90).
Alginate production ability was found in 87.8% (n=79/90), in which 7.6% (n=6/79) were <250 µgml-1, 53.2% (n=42/79) between 250-400 µgml-1, and 39.2% (n=31/79) >400 µgml-1.  Alginate production level in P. aeruginosa 8821M strain was 470 µgml-1. Among 35.5% (n=32/90) of MDR isolates, 15.6% (n=5/32) produced <250 μgml-1, 59.4% isolates (n=19/32) produced 250-400 μgml-1, and 25.0% (n=8/32) produced >400 μgml-1 alginate. The level of alginate production was not significantly related to the antibiotic resistance (P>0.05), but it was significantly related to the biofilm production (P<0.05). The alginate-encoding genes, algD, algU, and algL, were detected in 92.2% (n=83/90), 86.6% (n=78/90), and 67.7% (n=61/90) of the isolates, respectively. Compared to the alginate-free strains, the frequency of these genes was significantly higher in alginate-producing strains.
In general, 60.0% (n=54/90) of the isolates were able to form biofilm. Among 60.0% biofilm-producing isolates, 51.8% (n=28/54) were MDR. There was a significant relationship between biofilm production and antibiotic resistance (P<0.05). According to the OD cut-offs, category of biofilm formation was as follows; weak (n=6/54, 11.1%), moderate (n=13/54, 24.1%) and strong (n=35/54, 64.8%). A significant relationship was observed between the level of alginate production (>400 µgml-1) and intensity of biofilm formation, so that in strong biofilm-forming strains (ODt ≥ 4xODc), more alginate levels were produced (P<0.05). All biofilm-producing isolates were positive for ppyR gene. The pslA and pelA genes were present in 85.2% (n=46/54) and 42.5% (n=23/54) of the biofilm producing isolates, respectively. The prevalence of pslA and pelA genes in alginate-producer isolates were 35.4% (n=28/79) and 17.7% (n=14/79), respectively.

Table 2. Resistance profiling, biofilm formation and alginate production
Strain number Antibiotic resistance Biofilm phenotype Biofilm-encoded genes Alginate-production
1 ATM/ FEP/ TET/ CIP Weak ppyR / pelA/ algD/ algU/ algL <250 µgml-1
2 CAZ/ TET / CIP/ SXT Moderate ppyR / pelA/ algD/ algU/ algL 250-400 µgml-1
3 CAZ/ATM/ IPM / CTX/ AN Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
4 ATM/ FEP/ CIP/ IPM Strong ppyR / pslA/ pelA/ algD/ algL >400 µgml-1
5 CAZ/ TET / IPM/ SXT/ AN non- Biofilm algD/ algU/ algL 250-400 µgml-1
6 CAZ/ATM/ FEP / TET/ CIP/ IPM/ CTX/ AMP Strong ppyR/ pslA/ pelA/ algD/ algU/ algL >400 µgml-1
7 ATM/ TET/ IPM non- Biofilm algD 250-400 µgml-1
8 ATM/ FEP/ CIP/ AMP Weak ppyR / pelA/ algD/ algU/ algL <250 µgml-1
9 CAZ/ TET / CIP/ SXT/ AN/ GM Strong ppyR / pslA/ algD/ algU/ algL 250-400 µgml-1
10 CAZ/ FEP/ TET / IPM/ AMP/ AN/ GM Strong ppyR/ pslA / algD/ algU/ algL >400 µgml-1
11 CAZ/ATM/ TET / IPM Moderate ppyR / pelA/ algD/ algU/ algL <250 µgml-1
12 CAZ/ATM/ FEP/ TET/ CIP / IPM/ AMP Strong ppyR / pelA/ algD/ algU/ algL >400 µgml-1
13 CAZ/ FEP/ CIP/ IPM / GM Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
14 ATM/ CIP/ IPM/ AN non- Biofilm algD/ algL Non-alginate
15 CAZ / CIP/ IPM/ SXT Weak ppyR / pelA/ algD/ algU/ algL 250-400 µgml-1
16 CAZ/ FEP/ TET / AN Moderate ppyR / pslA/ algD/ algU/ algL 250-400 µgml-1
17 CAZ/ATM/ CIP / SXT Moderate ppyR / pslA/ pelA/ algD/ algU/ algL 250-400 µgml-1
18 ATM/ TET/ CIP/ IPM non- Biofilm algD/ algU/ algL Non-alginate
19 CAZ/ FEP / TET/ IPM non- Biofilm algD/ algU Non-alginate
20 CAZ/ATM / CIP/ IPM Moderate ppyR / pslA/ pelA/ algD/ algU/ algL 250-400 µgml-1
21 CAZ/ FEP / CIP/ IPM/ AMP/ GM Strong ppyR / pslA/ pelA/ algD/ algU/ algL >400 µgml-1
22 CAZ/ FEP/ TET / IPM non- Biofilm algD/ algU/ algL 250-400 µgml-1
23 ATM/ FEP/ CIP/ AMP Moderate ppyR/ pslA/ pelA/ algD/ algU/ algL 250-400 µgml-1
24 FEP/ TET/ CIP/ AMP non- Biofilm algD/ algL Non-alginate
25 ATM/ TET/ IPM/ AN/ GM Strong ppyR/ pslA/ pelA/ algD/ algU/ algL >400 µgml-1
26 CAZ/ FEP / CIP/ IPM non- Biofilm algD 250-400 µgml-1
27 CAZ/ATM / IPM/ CTX/ GM non- Biofilm algD/ algL <250 µgml-1
28 CAZ/ FEP/ TET / IPM/ GM Strong ppyR/ pslA/ pelA/ algD/ algU >400 µgml-1
29 CAZ/ FEP / TET/ IPM non- Biofilm algD/ algL 250-400 µgml-1
30 CAZ/ATM/ FEP/ CIP / CTX/ AMP Strong ppyR/ pelA/ algD/ algU/ algL >400 µgml-1
31 CAZ/ FEP / TET/ CTX non- Biofilm algD/ algL 250-400 µgml-1
32 CAZ/ FEP / IPM/ AMP/ AN Strong ppyR/ pslA/ pelA/ algD/ algU/ algL >400 µgml-1
33 CAZ/ATM / CIP/ CTX/ AN non- Biofilm algD/ algU 250-400 µgml-1
34 CAZ/ FEP / TET/ IPM non- Biofilm algD/ algL Non-alginate
35 CAZ / CIP/ SXT/ AMP Weak ppyR / pslA/ algD/ algU/ algL <250 µgml-1
36 CAZ, ATM/ FEP/ SXT Moderate ppyR / pslA/ algD/ algU/ algL 250-400 µgml-1
37 FEP/ TET/ CIP/ SXT/ GM Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
38 ATM/ FEP/ IPM/ SXT/ CTX non- Biofilm algD Non-alginate
39 CAZ/ FEP / IPM/ CTX Moderate ppyR / pslA/ pelA/ algD/ algU/ algL 250-400 µgml-1
40 CAZ / TET/ CIP/ IPM/ CTX/ AMP Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
41 CAZ/ATM/ FEP / IPM Strong ppyR / pslA/ algD/ algU/ algL 250-400 µgml-1
42 ATM/ FEP/ TET/ IPM/ AMP/ AN Strong ppyR / pslA/ pelA/ algD/ algU/ algL >400 µgml-1
43 CAZ/ATM / CIP/ CTX Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
44 CAZ/ FEP/ SXT/ AN/ GM Strong ppyR / pslA/ algD/ algU/ algL 250-400 µgml-1
45 CAZ/ATM/ FEP/ TET/ GM /IPM / SXT Strong ppyR / pslA/ pelA/ algD/ algU/ algL >400 µgml-1
46 CAZ/ATM/ FEP/ CIP/ IPM/ SXT Strong ppyR/ pslA/ algD/ algU/ algL >400 µgml-1
47 CAZ/ATM/ FEP non- Biofilm algD/ algU/ algL 250-400 µgml-1
48 CAZ/ATM/ CIP/ IPM Moderate ppyR / pslA/ algD/ algU/ algL 250-400 µgml-1
49 ATM/ FEP/ TET/ IPM Strong ppyR / pslA/ pelA/ algD/ algU/ algL >400 µgml-1
50 ATM/ TET/ CIP/ AMP non- Biofilm algD/ algU/ algL 250-400 µgml-1
51 CAZ / TET/ SXT/ CTX/ GM non- Biofilm algD/ algU/ algL 250-400 µgml-1
52 CAZ/ATM / CIP/ IPM non- Biofilm algD/ algU 250-400 µgml-1
53 CAZ/ATM/ FEP/ TET/ SXT / CTX/ AMP/ AN Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
54 ATM/ TET/ IPM/ SXT/ CTX Strong ppyR / algD/ algU/ algL >400 µgml-1
55 CAZ / TET/ CIP/ IPM Moderate ppyR / pslA/ algD/ algU >400 µgml-1
56 CAZ/ATM / IPM/ CTX non- Biofilm pslA/ algD/ algU/ algL 250-400 µgml-1
57 ATM/ FEP/ TET/ IPM non- Biofilm algD 250-400 µgml-1
58 ATM/ TET/ CIP/ IPM/ GM Strong ppyR/ pslA/ algD/ algU/ algL >400 µgml-1
59 CAZ/ATM/ FEP / SXT non- Biofilm algD/ algU/ algL >400 µgml-1
60 ATM/ FEP/ IPM/ CTX/ AMP/ GM Strong ppyR / pelA/ algD/ algU 250-400 µgml-1
61 CAZ/ATM / IPM/ SXT/ AMP/ AN Strong ppyR / pelA/ algD/ algU/ algL >400 µgml-1
62 CAZ/ATM/ FEP/ TET Moderate ppyR/ pslA / algD/ algU 250-400 µgml-1
63 CAZ/ATM / IPM/ CTX/ AN non- Biofilm pslA/ algD/ algU 250-400 µgml-1
64 CAZ/ATM/ FEP/ CIP non- Biofilm algD 250-400 µgml-1
65 CAZ/ATM/ TET/ IPM/ CTX/ GM Strong ppyR/ pslA/ algD/ algU 250-400 µgml-1
66 CAZ / TET/ IPM/ CTX non- Biofilm algD/ algU/ algL >400 µgml-1
67 CAZ/ FEP / IPM/ AMP/ AN/ GM Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
68 CAZ/ATM/ FEP / CIP/ IPM/ CTX/ AMP/ GM Strong ppyR / pslA/ algD/ algU 250-400 µgml-1
69 CAZ / TET/ IPM/ AN non- Biofilm algD/ algU Non-alginate
70 ATM/ TET/ IPM/ SXT Weak ppyR/ pslA/ algU/ algL <250 µgml-1
71 CAZ/ FEP / CIP/ IPM/ SXT non- Biofilm algD/ algU 250-400 µgml-1
72 CAZ / TET/ IPM/ GM non- Biofilm algU 250-400 µgml-1
73 CAZ / TET/ SXT/ GM Moderate ppyR / pslA/ algD/ algU/ algL >400 µgml-1
74 CAZ/ATM/ IPM / CTX/ AN/ GM Strong ppyR / pslA/ algD/ algU Non-alginate
75 CAZ/ATM/ FEP/ SXT / CTX/ AMP/ AN Strong ppyR / pslA/ algD/ algU Non-alginate
76 CAZ/ATM/ TET/ IPM non- Biofilm algU 250-400 µgml-1
77 CAZ/ATM/ FEP/ CTX/ GM non- Biofilm algD/ algU 250-400 µgml-1
78 CAZ/ATM/ TET/ IPM non- Biofilm algU 250-400 µgml-1
79 ATM/ FEP/ TET/ SXT/ AN non- Biofilm algU Non-alginate
80 CAZ / TET/ CIP/ IPM/ SXT/ CTX Strong ppyR/ pslA/ algD/ algU/ algL >400 µgml-1
81 CAZ / TET/ SXT/ AN non- Biofilm algU 250-400 µgml-1
82 ATM/ FEP/ TET/ CTX Weak ppyR/ pslA/ algD/ algU Non-alginate
83 CAZ/ATM / IPM/ SXT/ GM non- Biofilm algU 250-400 µgml-1
84 ATM/ FEP/ SXT/ CTX/ AMP/ AN/ GM Strong ppyR/ pslA/ algD/ algU/ algL >400 µgml-1
85 CAZ/ FEP / IPM/ SXT non- Biofilm algD/ algU 250-400 µgml-1
86 CAZ/ATM / IPM/ CTX/ AN non- Biofilm algD/ algU 250-400 µgml-1
87 CAZ/ATM/ SXT Moderate ppyR / pslA/ pelA/ algD/ algU/ algL 250-400 µgml-1
88 ATM/ FEP/ TET/ IPM/ SXT/ CTX/ AN/ GM Strong ppyR / pslA/ algD/ algU/ algL >400 µgml-1
89 CAZ/ FEP / SXT/ CTX non- Biofilm algD/ algU/ algL 250-400 µgml-1
90 CAZ/ATM/ FEP/ SXT / AN/ GM Strong ppyR/ pslA/ algD/ algU/ algL >400 µgml-1
Ciprofloxacin (CIP), ceftazidime (CAZ), cefotaxime (CTX), tetracycline (TET), imipenem (IPM), ampicillin (AMP), cefepime (FEP), aztreonam (ATM), amikacin (AN), gentamicin (GM), and trimethoprim-sulfamethoxazole (SXT).


 

Discussion

Since the emergence of resistant strains of P. aeruginosa, the treatment of these infections has become a major challenge worldwide (3). Antimicrobial resistance and biofilm formation are considered the most important challenges in the treatment of these infections (4).
Antimicrobial susceptibility testing results showed the highest resistance rate related to CAZ (74.4%), ATM (63.3%), FEP (54.4%), TET (50.0%), and CIP (36.7%). Thus, 63.3% of the isolates were carbapenem-resistant strains (CRPA). These data are in agreement with Ramazani et al (15) and Davarzani et al (16) results. The emergence of CRPA strains around the world is a major challenge, because carbapenems are considered as reliable and widely used treatment options in the treatment of these infections. In contrast with our data, the prevalence of CRPA was 24.7% in Ramazani et al (15) and 6.3% in Pournajaf et al (18) studies. One of the reasons for the increase in carbapenem resistance can be mentioned the excessive use and transfer of resistance genes by transposable elements (TEs) such as plasmid, integron, and transposon.
In a 10-years longitudinal study in Taiwan (SMART 202-2021), Karlowsky et al (19) reported 17.3% (n=520/3013) CRPA isolates. The frequency of CRPA increased from 11.5%–12.3% (2012–2015) to 19.4%–22.8% (2018–2021) (P≤0.0001). Vaez et al (20) reported a different distribution of resistance to IPM in different provinces of Iran (from 76.1% in Isfahan to 7.5% in Hamedan).
This wide distribution of CRPA strains has become a major challenge in treatment, which indicates a lack in adherence of antibiotic stewardship and proper monitoring of rational antibiotic prescribing. Therefore, based on the previous studies, poly-therapy and alternative treatment is suggested instead of mono-therapy (21, 22).
Consistent with Pournajaf et al (18) and Ghadaksaz et al (23), alginate production was found in 87.8% of our isolates, which consist of 7.6% <250 µgml-1, 53.2% between 250-400 µgml-1, and 39.2% >400 µgml-1. In agreement with Davarzani et al (16), the level of alginate production was not significantly related to the antibiotic resistance, but it was related to the biofilm production. Also, alginate production was <400 μgml-1, 250-400 μgml-1 and >250 μgml-1 in 39.0% (n=39/100), 51.0% (n=51/100) and 10.0% (n=10/100) of the isolates, respectively.
In contrast with our data, Valadbeigi et al (24) and Davarzani et al (16) showed a high distribution of alginate production in burn and urine samples, respectively. While in line with Pournajaf et al (18), the highest level of alginate was found in respiratory samples. This could explain the role of non-pilous adhesions such as alginate in the colonization of microbes in the airways.
Similar with Pournajaf et al (18) and Ghadaksaz et al (23), the prevalence of algD, algU and algL genes in our isolates was 92.2%, 86.6% and 67.7%, respectively. The prevalence of algD gene in the studies directed by Elogne et al (25) and Rajabi et al (26) was 90.7% (n=129/151) and 78.6% (n=66/85), respectively. The variation in the distribution of alginate-coding genes is mostly related to the type and volume of the samples.
Alginate protects bacteria from the adversities surrounding environment and also increases adhesion to the solid surfaces. Therefore, it plays an important role in the early stages of infection and colonization. The presence of this layer prevents the clearance of the organism by the immune system (27).
The microtiter biofilm formation assay is a simplified quantitative and reliable method that is comparable among different laboratories to detect biofilm-forming bacteria (18, 28, 29). Overall, 60.0% of our isolates were able to form biofilm, including weak (11.1%), moderate (24.1%) and strong (64.8%) producers. Kamali et al (30) showed 83.7% (n=67/80) of the isolates produced biofilm; 16.2% (n=13/80) strong, 33.7% (n=27/80) moderate, and 33.7% (n=27/80) weak biofilm producers.
In line with Davarzani et al (16), there was a significant relationship between the level of alginate production (>400 µgml-1) and strong biofilm-forming strains. Molecular distribution of biofilm-encoded genes showed that all biofilm-producing isolates were positive for ppyR gene. The pslA and pelA genes were present in 85.2% and 42.5% of biofilm producing isolates, respectively. Ghadaksaz et al (23) showed that 99.0%, 83.7% and 45.2% of the isolates carried ppyR, pslA, pelA genes, respectively. Soleymani-Fard et al (31) showed that the prevalence of pslA and pelB genes was 34.5% and 65.5%, respectively. The difference in distribution of the biofilm-coding genes can be caused by the type and size of the sample, geographical distance, and genetics of the strains.


 

Conclusion

The results highlight an alarming trend in P. aeruginosa strains antibiotic resistance rate. Thus, periodic monitoring, adherence to the antibiotic stewardship, avoiding arbitrary drugs prescribing, and screening tests are necessary and unavoidable. The formation of biofilm and alginate plays an important role in pathogenesis. Furthermore, poly-therapy based on the appropriate anti-pseudomonal antimicrobials with anti-biofilm agents can be used to enhance the treatment of biofilm-associated illnesses.

 

Acknowledgment

The authors express their gratitude to the Research and Technology Vice-Chancellor of Babol University of Medical Sciences for their support.
 
 

Ethical Considerations

This cross-sectional study was approved by the Ethics Committee of Babol University of Medical Sciences (code number IR.IAU.AMOL.REC.1401.064).


 

Authors’ Contributions

Maryam Shafigh and Abazar Pournajaf conceived and designed the experiments. Abazar Pournajaf wrote the main manuscript text. Hami Kaboosi, Rabie Izadi Amoli, and Yousef Yahyapour performed the experiments. Maryam Shafigh analyzed the data. Maryam Shafigh and Abazar Pournajaf reviewed and finalized the manuscript. All authors contributed to the article and approved the submitted version.


 

Financial Support and Sponsorship

This paper was not funded.

 

Conflicts of Interest

The authors declare no conflict of interest.

 
 

Type of Study: Original Research Article | Subject: Medical Bacteriology
Received: 2024/08/17 | Accepted: 2024/11/14 | ePublished: 2024/11/30

References
1. Rocha AJ, Barsottini MR, Rocha RR, Laurindo MV, Moraes FL, Rocha SL. Pseudomonas aeruginosa: virulence factors and antibiotic resistance genes. Braz J Med Biol Res. 2019;62:e19180503. [DOI:10.1590/1678-4324-2019180503]
2. Kaier K, Heister T, Götting T, Wolkewitz M, Mutters NT. Measuring the in-hospital costs of Pseudomonas aeruginosa pneumonia: methodology and results from a German teaching hospital. BMC Infect Dis. 2019;19:1-8. [DOI:10.1186/s12879-019-4660-5] [PMID] [PMCID]
3. Ammazzalorso A, Granese A, De Filippis B. Recent trends and challenges to overcome Pseudomonas aeruginosa infections. Expert Opin Ther Pat. 2024;34(6):493-509. [DOI:10.1080/13543776.2024.2348602]
4. Fernández-Billón M, Llambías-Cabot AE, Jordana-Lluch E, Oliver A, Macià MD. Mechanisms of antibiotic resistance in Pseudomonas aeruginosa biofilms. Biofilm. 2023;5:100129. [DOI:10.1016/j.bioflm.2023.100129] [PMID] [PMCID]
5. Kothari A, Kherdekar R, Mago V, Uniyal M, Mamgain G, Kalia RB, et al. Age of Antibiotic Resistance in MDR/XDR Clinical Pathogen of Pseudomonas aeruginosa. Pharmaceuticals. 2023;16(9):1230. [DOI:10.3390/ph16091230] [PMID] [PMCID]
6. Thi MTT, Wibowo D, Rehm BH. Pseudomonas aeruginosa biofilms. Int J Mol Sci. 2020;21(22):8671. [DOI:10.3390/ijms21228671] [PMID] [PMCID]
7. Peng N, Cai P, Mortimer M, Wu Y, Gao C, Huang Q. The exopolysaccharide-eDNA interaction modulates 3D architecture of Bacillus subtilis biofilm. BMC Microbiol. 2020;20:115. [DOI:10.1186/s12866-020-01789-5] [PMID] [PMCID]
8. Colvin KM, Irie Y, Tart CS, Urbano R, Whitney JC, Ryder C, et al. The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environ Microbiol. 2012;14(8):1913-28. [DOI:10.1111/j.1462-2920.2011.02657.x] [PMID] [PMCID]
9. Colvin KM, Gordon VD, Murakami K, Borlee BR, Wozniak DJ, Wong GC, et al. The pel polysaccharide can serve a structural and protective role in the biofilm matrix of Pseudomonas aeruginosa. PLoS Pathog. 2011;7(1):e1001264. [DOI:10.1371/journal.ppat.1001264] [PMID] [PMCID]
10. Hentzer M, Teitzel GM, Balzer GJ, Heydorn A, Molin S, Givskov M, et al. Alginate overproduction affects Pseudomonas aeruginosa biofilm structure and function. J Bacteriol. 2001;183(18):5395-401. [DOI:10.1128/JB.183.18.5395-5401.2001] [PMID] [PMCID]
11. May TB, Chakrabarty A. Pseudomonas aeruginosa: genes and enzymes of alginate synthesis. Trends Microbiol. 1994;2(5):151-7. [DOI:10.1016/0966-842X(94)90664-5] [PMID]
12. Chung J, Eisha S, Park S, Morris AJ, Martin I. How three self-secreted biofilm exopolysaccharides of Pseudomonas aeruginosa, Psl, Pel, and alginate, can each be exploited for antibiotic adjuvant effects in cystic fibrosis lung infection. Int J Mol Sci. 2023;24(10):8709. [DOI:10.3390/ijms24108709] [PMID] [PMCID]
13. Blanco-Cabra N, Paetzold B, Ferrar T, Mazzolini R, Torrents E, Serrano L, et al. Characterization of different alginate lyases for dissolving Pseudomonas aeruginosa biofilms. Sci Rep. 2020;10(1):9390. [DOI:10.1038/s41598-020-66293-2] [PMID] [PMCID]
14. Abidi SH, Sherwani SK, Siddiqui TR, Bashir A, Kazmi SU. Drug resistance profile and biofilm forming potential of Pseudomonas aeruginosa isolated from contact lenses in Karachi-Pakistan. BMC Ophthalmol. 2013;13:1-6. [DOI:10.1186/1471-2415-13-57] [PMID] [PMCID]
15. Ramazani R, Izadi Amoli R, Taghizadeh Armaki M, Pournajaf A, Kaboosi H. A molecular New Update on the Biofilm Production and Carbapenem Resistance Mechanisms in Clinical Pseudomonas aeruginosa Isolates. Iran J Med Microbiol. 2022;16(6):557-65. [DOI:10.30699/ijmm.16.6.557]
16. Davarzani F, Saidi N, Besharati S, Saderi H, Rasooli I, Owlia P. Evaluation of antibiotic resistance pattern, alginate and biofilm production in clinical isolates of Pseudomonas aeruginosa. Iran J Public Health. 2021;50(2):341. [DOI:10.18502/ijph.v50i2.5349] [PMID] [PMCID]
17. Humphries R, Bobenchik AM, Hindler JA, Schuetz AN. Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100. J Clin Microbiol. 2021;59(12):10-128. [DOI:10.1128/JCM.00213-21] [PMID] [PMCID]
18. Pournajaf A, Razavi S, Irajian G, Ardebili A, Erfani Y, Solgi S, et al. Integron types, antimicrobial resistance genes, virulence gene profile, alginate production and biofilm formation in Iranian cystic fibrosis Pseudomonas aeruginosa isolates. Infez Med. 2018;26(3):226-36.
19. Karlowsky JA, Wise MG, Hsieh T-C, Lu H-C, Chen W-T, Cheng M-H, et al. Temporal and geographical prevalence of carbapenem-resistant Pseudomonas aeruginosa and the in vitro activity of ceftolozane/tazobactam and comparators in Taiwan-SMART 2012-2021. J Glob Antimicrob Resist. 2023;34:106-12. [DOI:10.1016/j.jgar.2023.06.013] [PMID]
20. Vaez H, Salehi-Abargouei A, Ghalehnoo ZR, Khademi F. Multidrug resistant Pseudomonas aeruginosa in Iran: A systematic review and metaanalysis. J Glob Infect Dis. 2018;10(4):212-7. [DOI:10.4103/jgid.jgid_113_17] [PMID] [PMCID]
21. Malik MA, Wani MY, Hashmi AA. Chapter 1 - Combination therapy: Current status and future perspectives. In Combination Therapy Against Multidrug Resistance. 2020. pp. 1-38. New York, United States: Academic press. [DOI:10.1016/B978-0-12-820576-1.00001-1]
22. Lai X, Han M-L, Ding Y, Chow SH, Le Brun AP, Wu C-M, et al. A polytherapy based approach to combat antimicrobial resistance using cubosomes. Nat Commun. 2022;13(1):343. [DOI:10.1038/s41467-022-28012-5] [PMID] [PMCID]
23. Ghadaksaz A, Fooladi AAI, Hosseini HM, Amin M. The prevalence of some Pseudomonas virulence genes related to biofilm formation and alginate production among clinical isolates. J Appl Biomed. 2015;13(1):61-8. [DOI:10.1016/j.jab.2014.05.002]
24. Valadbeigi H, Sadeghifard N, Rafiei Tabatabaei R, Maleki A. A study on the frequency of toxin A, alginate genes, and of clinical Pseudomonas aeroginosa strains. J Ilam Univ Med Sci. 2012;20(1):58-64.
25. Elogne CK, N'Guetta A, Yeo A, David C, Guessennd N, Anné JC, et al. Prevalence of Pseudomonas aeruginosa's virulence genes isolated from human infection in Abidjan, Côte d'Ivoire. Microbiol Res J Int. 2018;25(1):1-8. [DOI:10.9734/MRJI/2018/44475]
26. Rajabi H, Salimizand H, Khodabandehloo M, Fayyazi A, Ramazanzadeh R. Prevalence of algD, pslD, pelF, Ppgl, and PAPI-1 genes involved in biofilm formation in clinical Pseudomonas aeruginosa strains. Biomed Res Int. 2022;2022(1):1716087. [DOI:10.1155/2022/1716087] [PMID] [PMCID]
27. Skariyachan S, Sridhar VS, Packirisamy S, Kumargowda ST, Challapilli SB. Recent perspectives on the molecular basis of biofilm formation by Pseudomonas aeruginosa and approaches for treatment and biofilm dispersal. Folia Microbiologica. 2018;63:413-32. [DOI:10.1007/s12223-018-0585-4] [PMID]
28. Hassan A, Usman J, Kaleem F, Omair M, Khalid A, Iqbal M. Evaluation of different detection methods of biofilm formation in the clinical isolates. Braz J Infect Dis. 2011;15:305-11. https://doi.org/10.1016/S1413-8670(11)70197-0 [DOI:10.1590/S1413-86702011000400002] [PMID]
29. Stepanović S, Vuković D, Hola V, Bonaventura GD, Djukić S, Ćirković I, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. J Pathol Microbiol Immunol. 2007;115(8):891-9. [DOI:10.1111/j.1600-0463.2007.apm_630.x] [PMID]
30. Kamali E, Jamali A, Ardebili A, Ezadi F, Mohebbi A. Evaluation of antimicrobial resistance, biofilm forming potential, and the presence of biofilm-related genes among clinical isolates of Pseudomonas aeruginosa. BMC Res Notes. 2020;13:1-6. [DOI:10.1186/s13104-020-4890-z] [PMID] [PMCID]
31. Soleymani-Fard Z, Hassanshahian M, Jasim SA, Abdelbasset WK, Shichiyakh RA, Hussein BA, et al. Screening of pslA and pelB Biofilm-Producing Genes from Pseudomonas Isolated from Clinical Samples. Proc Natl Acad Sci India Sect B Biol Sci. 2024;94:519-25. [DOI:10.1007/s40011-024-01547-x]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc