Prevalence, Antimicrobial Susceptibility, and Distribution of Virulence Genes Involved in Biofilm Formation in Multidrug-Resistant Acinetobacter baumannii Isolated from Shahrekord Medical Centers, Chaharmahal and Bakhtiari, Iran

Ghadiri, Amirhossein; Doosti, Abbas; Shakhsi-Niaei, Mostafa

doi:10.30699/ijmm.17.1.73

year 17, Issue 1 (January - February 2023) Iran J Med Microbiol 2023, 17(1): 73-80 | Back to browse issues page

‎ 10.30699/ijmm.17.1.73

Mendeley

Zotero

RefWorks

Ghadiri A, Doosti A, Shakhsi-Niaei M. Prevalence, Antimicrobial Susceptibility, and Distribution of Virulence Genes Involved in Biofilm Formation in Multidrug-Resistant Acinetobacter baumannii Isolated from Shahrekord Medical Centers, Chaharmahal and Bakhtiari, Iran. Iran J Med Microbiol 2023; 17 (1) :73-80
URL: http://ijmm.ir/article-1-1784-en.html

Prevalence, Antimicrobial Susceptibility, and Distribution of Virulence Genes Involved in Biofilm Formation in Multidrug-Resistant Acinetobacter baumannii Isolated from Shahrekord Medical Centers, Chaharmahal and Bakhtiari, Iran

Amirhossein Ghadiri¹

, Abbas Doosti

², Mostafa Shakhsi-Niaei³

1- Department of Biology, Faculty of Basic Sciences, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
2- Biotechnology Research Center, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran , abbasdoosti@yahoo.com
3- Department of Genetics, Faculty of Basic Sciences, Shahrekord University, Shahrekord, Iran

Keywords: Acinetobacter baumannii, Antibiotic resistance, Biofilm, Virulence genes

Full-Text [PDF 541 kb] (431 Downloads) | Abstract (HTML) (1974 Views)

Full-Text: (440 Views)

Introduction

Antimicrobial or antibiotic resistance is an important worldwide phenomenon that has increased health costs. In recent years, mortality among patients infected with this bacterium has increased significantly due to the longer hospitalization and treatment with complications (1). Although new antimicrobial agents have been used against this microorganism in the past decades, resistance to these agents seems to be a growing problem worldwide. Numerous pieces of research in recent decades have shown that community-acquired and hospital-acquired resistance is growing along with an increasing number of older patients with primary or secondary immunodeficiency (1, 2). Acinetobacter baumannii is a critical opportunistic pathogen responsible for a relatively high rate of healthcare-related infections. Infections caused by this bacterium are diverse and include acquired and ventilator-associated pneumonia, urinary tract infections, meningitis, bacteremia, gastrointestinal or skin infections, and ulcers (3). A. baumannii strains usually show incredible antimicrobial resistance. Many isolated samples are often resistant to a wide range of clinically effective antibiotics. Accordingly, they are classified into two categories: multidrug-resistant strains (MDR) or extensively drug-resistant bacteria strains (XDR) (4). Due to the vital effect of multidrug-resistant A. baumannii on public health, the World Health Organization has classified this organism as the priority pathogen among antibiotic-resistant microorganisms (5). Recent reports have shown that the environment is the principal source of multidrug-resistant A. baumannii in health facility settings (6). This in turn has contributed to the wide spread of this pathogen worldwide (7).
A biofilm can be defined as a collection of microorganisms that are trapped in a matrix. This matrix acts as a protector and increases microorganisms' ability to resist environmental stressors and various antibiotics (8). The ability to form biofilms plays a crucial role in the survival of this bacterium (9). It also enables bacteria to transport easily in hospital environments and contaminate various biological and non-biological surfaces such as vascular catheters, urinary catheters, and cerebrospinal fluid shunts (10).
Despite the increasing importance of A. baumannii as a multidrug-resistant bacterium in nosocomial infections, the function, and mechanism of virulence elements related to the pathogenesis of this bacterium in human infections stay in large part obscure. Recently, animal models of disorder and cellular infection have supplied valuable data on the pathogenesis mechanisms of this bacterium. Some factors associated with this bacterium seem like very essential in causing disease, including outer membrane purines, surface structures such as capsules and lipopolysaccharides, various enzymes, iron-acquisition systems, and regulatory proteins. These virulence factors are involved in the infection process, including transmission, attachment to host structures, cell damage, and invasion (11). The relevance between biofilm formation, antibiotic resistance, and the presence of virulence factors have been of excellent interest to researchers. The nature of this correlation has been controversial and changing over the past two decades. Some studies have suggested that the resistance factors obtained by A. baumannii determine its capacity for biofilm formation. Further, MDR or XDR strains of A. baumannii have shown a better capability to form biofilms as compared to susceptible strains (4, 12). The aim of this study was to investigate the prevalence, antimicrobial susceptibility, and distribution of virulence genes involved in biofilm formation in multidrug-resistant samples of A. baumannii isolated from Shahrekord medical centers in Chaharmahal and Bakhtiari Province.

Materials and Methods

Isolation and Identification of Strains
In this cross-sectional descriptive study, 150 samples were collected randomly from Shahrekord medical centers in Chaharmahal and Bakhtiari Province between 2020 and 2021. The samples included blood, urine, wounds, trachea, and respiratory samples. Based on microbiological and biochemical tests such as gram staining, oxidase, catalase, aerobic and anaerobic OF, TSI, indole, motility (SIM), Simon citrate, MR-VP, and lactose fermentation in McConkey agar (Merck, Germany) medium, A. baumannii isolates were identified and included in the study. Samples that did not have these characteristics were excluded.
Antimicrobial Susceptibility Testing
Antimicrobial susceptibility of A. baumannii isolates was tested using the standard disk diffusion method (Kirby-Bauer) according to CLSI 2019 standard using these antibiotics, Ampicillin / Sulbactam (10/10 μg), Doxycycline (30 μg), Ceftazidime (30 μg), Ciprofloxacin (5 μg), Erythromycin (15 μg), Trimethoprim / Sulfamethoxazole (1.25 / 23/75 μg), Gentamicin (10 μg), Amikacin (30 μg), Imipenem (10 μg), and Colistin (10 μg) (MAST, Merseyside, U.K). Multidrug resistance (MDR) was defined as resistance to at least one agent in three or more classes of antibiotics (13).
Biofilm Formation Assay
The biofilm formation potential of A. baumannii isolates was determined by the microtiter plate method. In brief, A. baumannii isolates were grown overnight in tryptic soy broth (TSB) medium at 37°C. Free cells were eliminated, and the biofilm was washed three times with phosphate-buffered saline (PBS) and fixed with methanol. Wells were stained with 1% (w/v) crystal violet for 20 min at room temperature. Crystal violet was dissolved in 33% ethanol/acetone solution (80, 20, v/v) for 20 minutes, and the absorbance was measured at 595 nm. Biofilm formation severity was defined in Table 1 (14).

Table 1. Classification of bacteria based on the strength of biofilm formation

Absorbance	Biofilm score
A <1	non-biofilm production
1<A≤2	weak
2<A≤3	moderate
A≥3	strong

DNA Extraction

Genomic DNA extraction was done from an overnight culture of Acinetobacter baumannii isolates using a DNA extraction kit (Sinaclon, Iran) according to the kit instructions.

Detection of Virulence Genes Associated with Biofilm Formation

The presence of genes related to biofilm formation, including bap, ompA, csuA, csuE, epsA, bfmS, bfmR, pgaA, pgaD, and surA was assessed by PCR. The sequence of primers is given in Table 2. PCR was performed using Master mix 2x (SinaClon, Iran). Each PCR tube contained 25 μL of the reaction mixture, which includes 12.5 μL of Mastermix, 1 μL of each forward and reverse primers, 1 μL of DNA at a concentration of 200 ng/μL and nuclease-free water to complete the volume. PCR program included initial denaturation at 94°C for 5 minutes, then 30 cycles of denaturation (94°C, 1 min), annealing (annealing temperature was considered to be 59°C for all genes) for 1 minute, extension at 72°C for 1 min, and then final extension at 72°C for 10 min. PCR products were electrophoresed on 1% agarose gel containing ethidium bromide and were observed by gel documentation.

Table 2. Primers Sequences used in this study

Reference	amplicon Size (bp)	Primers sequences (5' to 3')	Target Genes
(15)	108	F: GAGGGAACTTCTGCAAAACTTTC	*bap*
		R: CAGACGTATGACTGCATTGGT
(15)	594	F: GAGTCGTATTGCACTTGCTAC	*ompA*
		R: GCAGGCTTCAAGTGACCACC
(16)	322	F: TGGTGAAGCTACCACAGGTT	*csuA*
		R: ACGACTACCATCATGGGCTG
(15)	751	F: ACCAATGCTCAGACCGGAG	*csuE*
		R: CTTGTACCGTGACCGTATCTTG
(15)	602	F: AAACATTACCAGCGATACAACC	*epsA*
		R: CTGGTTTTCTCGTGTGCTGAC
(15)	990	F: CATTAGTGAAGGAGTCGCTCG	*bfmS*
		R: GGTGTACCCTGCTCTAGTTTT
(15)	557	F: GAAGTTGGTGTAGAAACCGATG	*bfmR*
		R: GGATTTTCAGGATCATCGCC
(15)	460	F: ATTCAAAAGTCAGTTGATGGGC	*pgaA*
		R: TTTTTTGTCCTTGCTCCAGC
(15)	353	F: CCCCTGCTCATCATAATGTAAG	*pgaD*
		R: GGTTTTGTTTAATGTGGCTGC
(16)	822	F: GATGCGATTGCACCTGGAAC	*surA*
		R: TTGACGTGCCATACGCTCTT

Statistical Analysis
Statistical analysis was performed using SPSS software version 22 (SPSS Inc., Chicago, IL., USA), and the correlation between antibiotic resistance and frequency of virulence genes was investigated by T-test.

Results

Identification of A. baumannii

Microbiological and biochemical tests were performed to determine the definitive strains of A. baumannii. For this purpose, all 150 samples were cultured on MacConkey Agar and Blood Agar medium and incubated at 37°C for 24 hours. Gram staining was performed to confirm the presence of gram-negative coccobacilli using the microscopic method. Biochemical tests, including IMVIC, urease, TSI, OF, MR-VP, SIM, catalase, oxidase, and growth at 37 and 42°C were then performed. Finally, isolates that were lactose-negative, immobilized, oxidase-negative, catalase-positive, indole-negative, pigment-negative, urease-positive, citrate-positive, H2S-negative, MR, and VP-negative (90 samples) were confirmed as A. baumannii. After that, all samples were stored in peptone water containing 20% glycerol at -80°C.

Antimicrobial Susceptibility

The antimicrobial susceptibility pattern of the isolates is presented in Tables 3 and 4. In general, all isolates were resistant to one or more antimicrobial agents, with the highest resistance to Ciprofloxacin and Imipenem (100%), followed by Ceftazidime (90%) and Ampicillin/Sulbactam (77.77%). All isolates were resistant to at least one agent from three or more antimicrobial classes and were considered MDR. The most common patterns of MDR were resistance to Ampicillin/Sulbactam, Doxycycline, Ceftazidime, Ciprofloxacin, Erythromycin, Trimethoprim /Sulfamethoxazole, Gentamicin, Amikacin, Imipenem with a frequency of 30% (Table 3).

Table 3. Antibiotic resistance assessment of A. baumannii isolates

Antibiotic	Resistant N (%)	Intermediate N (%)	Susceptible N (%)
Ampicillin-Sulbactam	70 (77.77)	1 (1.11)	19 (21.11)
Doxycycline	55 (61.11)	7 (7.77)	28 (31.11)
Ceftazidime	81 (90)	0 (0)	9 (10)
Ciprofloxacin	90 (100)	0 (0)	0 (0)
Erythromycin	51 (56.67)	30 (33.33)	9 (10)
Trimethoprim-Sulfamethoxazole	53 (58.89)	24 (26.66)	13 (14.45)
Gentamicin	59 (65.55)	3 (3.33)	28 (31.12)
Amikacin	42 (46.66)	29 (32.23)	19 (21.11)
Imipenem	90 (100)	0 (0)	0 (0)
Colistin	0 (0)	0 (0)	90 (100)

Table 4. Antibiotic resistance patterns of A. baumannii isolates

Percent (%) of all isolates	Antibiotic resistance patterns	No. of antimicrobial agents
10	Ciprofloxacin, Gentamicin, Imipenem, Ampicillin-Sulbactam	4
18	Ceftazidime, Imipenem, Ciprofloxacin, Erythromycin, Gentamicin	5
22	Ceftazidime, Imipenem, Doxycycline, Ciprofloxacin, Gentamicin, Trimethoprim- Sulfamethoxazole, Amikacin	7
20	Ampicillin-Sulbactam, Ceftazidime, Ciprofloxacin, Erythromycin, Trimethoprim- Sulfamethoxazole, Gentamicin, Amikacin, Imipenem	8
30	Ampicillin-Sulbactam, Doxycycline, Ceftazidime, Ciprofloxacin, Erythromycin, Trimethoprim- Sulfamethoxazole, Gentamicin, Amikacin, Imipenem	9

Biofilm Formation Assay

All isolates of A. baumannii were capable of forming biofilms. A total of 12 isolates were weak, 28 isolates were moderate, and 50 isolates showed a solid ability to biofilm formation.

Distribution of Biofilm-related Genes

All identified samples of A. baumannii were tested for biofilm-forming virulence genes such as bap, ompA, csuA, csuE, epsA, bfmS, bfmR, pgaA, pgaD and surA. The results showed that the highest frequency of virulence genes associated with biofilm formation was related to bap (100%), ompA (100%), and pgaA / pgaD (98%). In this study, epsA gene was not observed in any isolates. The frequency of other genes studied in this study was bfmR / bfmS (96%), surA (94%), and csuA / csuE (90%).

Discussion

As an emerging pathogen, A. baumannii is responsible for causing a wide range of life-threatening infections (17). Increased regulation of intrinsic resistance mechanisms, including overexpression of efflux pumps and the acquisition of external genetic determinants such as plasmids, are vital features for the survival of this bacterium in harsh environments such as hospitals (18). The growing worldwide emergence of A. baumannii strains resistant to all antimicrobial agents highlights the ability of this microorganism for fast adaptation to selective environmental stressors. Multidrug-resistant A. baumannii (MDR) is one of the most difficult-to-treat antibiotic-resistant gram-negative bacilli (19).
In our study, 100% of A. baumannii isolates were resistant to one or more antimicrobial agents. The highest resistance was observed against Ciprofloxacin and Imipenem (100%), and Ceftazidime (90%). Sadeghi et al. reported the highest antibiotic resistance to Ceftazidime, Aztreonam, and Ciprofloxacin during a study in Shahrekord, which is very similar to the present study (20). Recently, it has been shown that resistance to Ampicillin / Sulbactam is growing among A. baumannii isolates (21). In this study, there is a significant amount of Ampicillin / Sulbactam-resistant A. baumannii (77%), which poses another challenge in treating infections. The high incidence of antibiotic resistance is most likely due to improper use of antimicrobial agents. In addition, the loss and acquisition of resistance genes by mobile genetic elements (MGEs) is an important mechanism in the development of multidrug-resistant isolates. The study of antibiotic susceptibility of A. baumannii isolates shows high resistance of this bacterium to a wide range of antibiotics (22, 23). Based on previous studies in Iran, the frequency of multidrug-resistant A. baumannii isolates was between 32.7% and 93% (21). The outcomes of our study confirmed that 100% of A. baumannii isolates were MDR. The high incidence of MDR isolates has been reported in some research in Iran and different countries (24-28). Iran seems to be a hotbed for the emergence of MDR isolates of A. baumannii, which raises significant concerns in the healthcare sector.
The ability of colonization and biofilm formation on living and non-living surfaces by A. baumannii is an important factor. According to our results, all isolates of A. baumannii were capable of producing biofilms, and 55% of the isolates had the robust capability to shape biofilms. Our results are constant with previous studies showing that more than 75% of A. baumannii isolates constitute biofilms (29, 30). Numerous pieces of research have shown that biofilm-related genes such as csuE, ompA, bap, epsA, bfmS, and pgaABCD are responsible for biofilm formation and antibiotic resistance (31). According to our results, the most common genes were bap and ompA (100%). The results of the frequency percentage of genes in the present study are very similar to the study of Mozafari et al., in which the frequency of bap gene was reported to be 98% (16). Fallah et al. reported that the frequency of this gene was 92% (32). ompA is an outer membrane protein encoded by the ompA gene. This protein is important for binding to human epithelial cells, biofilm development, and antimicrobial resistance (29). The frequency of ompA was high in our study (100%). Bardbari et al. reported a 100% abundance of this gene in respiratory samples, which is very similar to the present study (33).
The pgaABCD gene locus plays a major role in polysaccharide synthesis and biofilm formation. Poly-N-acetylglucosamine is a major component of biofilms in microbial-host interactions, virulence, immune evasion, and protection against antibiotics. The pga gene locus encodes proteins involved in the synthesis and transport of poly-N-acetylglucosamine to the bacterial surface (34). In the present study, the frequency of pgaA and pgaD genes was 98%, which is very similar to the study of Al-Shamiri et al. (15).
In this study, the frequency of csuA and csuE genes was 90%, which is very similar to Mozafari et al. (16). The csu A/BABCDE family of proteins is involved in the assembly of pili and forming a biofilm on surfaces. The expression of these proteins is controlled by the bfmR/bfmS two-component regulatory system. This system is used to produce biofilm on plastic surfaces (35). Previous studies have shown that inactivation of the bfmR gene causes loss of ability to pili production, bind, and biofilm formation on plastic surfaces (36). In the present study, the frequency of bfmR and bfmS genes was 96%, which is very similar to the study of Mozafari et al. (16). The frequency of these genes has been reported to be excessive in clinical isolates. Thummeepak et al. reported a frequency of 84% for these genes (29).
surA is a serum resistance factor in Acinetobacter baumannii (8). In the present study, the frequency of surA gene was 94%, which is very similar to the study of Liu et al. and Mozafari et al. (11, 16).
In a few research, the similarity of the results with the outcomes of this study turned very low, which can be because of the kind of samples, study time, and the type of antibiotic discs used. In this study, all isolates of A. baumannii forming strong biofilms carried the bap and ompA genes simultaneously. However, these biofilm-related genes were additionally recognized in a few isolates of Acinetobacter baumannii, forming a medium biofilm, which was predicted to form a strong biofilm because of the excessive abundance of associated genes.

Conclusion

Our study showed a high occurrence of multidrug-resistant A. baumannii, which forms biofilm with an excessive prevalence of biofilm-associated genes, which include bap, ompA, pgaA, and pgaD. According to these results, appropriate regulatory and control measures are needed to prevent the transmission of resistant strains.

Acknowledgment

The authors would like to thank the members of the Biotechnology Research Center of the Islamic Azad University of Shahrekord in Iran for their help and support.

Conflicts of Interest

The authors declared no conflict of interest.

Type of Study: Original Research Article | Subject: Antibiotic Resistance
Received: 2022/06/13 | Accepted: 2022/08/11 | ePublished: 2023/01/20

References

1. Ayoub Moubareck C, Hammoudi Halat D. Insights into Acinetobacter baumannii: A Review of Microbiological, Virulence, and Resistance Traits in a Threatening Nosocomial Pathogen. Antibiotics. 2020;9(3):119. [DOI:10.3390/antibiotics9030119] [PMID] [PMCID]

2. Vrancianu CO, Gheorghe I, Czobor IB, Chifiriuc MC. Antibiotic Resistance Profiles, Molecular Mechanisms and Innovative Treatment Strategies of Acinetobacter baumannii. Microorganisms. 2020;8(6):935. [DOI:10.3390/microorganisms8060935] [PMID] [PMCID]

3. Nasr P. Genetics, epidemiology, and clinical manifestations of multidrug-resistant Acinetobacter baumannii. J Hosp Infect. 2020;104(1):4-11. [DOI:10.1016/j.jhin.2019.09.021] [PMID]

4. Qi L, Li H, Zhang C, Liang B, Li J, Wang L, et al. Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Front Microbiol. 2016;7:483. [DOI:10.3389/fmicb.2016.00483] [PMID] [PMCID]

5. Who WHO. Priority Pathogens List for R&D of New Antibiotics. WHO, Geneva, Switzerland; 2017.

6. Weinberg S, Villedieu A, Bagdasarian N, Karah N, Teare L, Elamin W. Control and management of multidrug resistant Acinetobacter baumannii: A review of the evidence and proposal of novel approaches. Infect Prev in Pract. 2020;2(3):100077-85. [DOI:10.1016/j.infpip.2020.100077] [PMID] [PMCID]

7. Yang C-H, Su P-W, Moi S-H, Chuang L-Y. Biofilm formation in Acinetobacter Baumannii: genotype-phenotype correlation. Molecules. 2019;24(10):1849. [DOI:10.3390/molecules24101849] [PMID] [PMCID]

8. Lee C-R, Lee JH, Park M, Park KS, Bae IK, Kim YB, et al. Biology of Acinetobacter baumannii: pathogenesis, antibiotic resistance mechanisms, and prospective treatment options. Front Cell Infect Microbiol. 2017;7:55. [DOI:10.3389/fcimb.2017.00055]

9. Wang Y-C, Huang T-W, Yang Y-S, Kuo S-C, Chen C-T, Liu C-P, et al. Biofilm formation is not associated with worse outcome in Acinetobacter baumannii bacteraemic pneumonia. Sci Rep. 2018;8(1):1-10. [DOI:10.1038/s41598-018-25661-9] [PMID] [PMCID]

10. Gedefie A, Demsis W, Ashagrie M, Kassa Y, Tesfaye M, Tilahun M, et al. Acinetobacter baumannii biofilm formation and its role in disease pathogenesis: a review. Infect Drug Resist. 2021;14:3711-9. [DOI:10.2147/IDR.S332051] [PMID] [PMCID]

11. Liu C, Chang Y, Xu Y, Luo Y, Wu L, Mei Z, et al. distribution of virulence-associated genes and antimicrobial susceptibility in clinical Acinetobacter baumannii isolates. Oncotarget. 2018;9(31):21663. [DOI:10.18632/oncotarget.24651] [PMID] [PMCID]

12. Chmielarczyk A, Pilarczyk-Żurek M, Kamińska W, Pobiega M, Romaniszyn D, Ziółkowski G, et al. Molecular Epidemiology and Drug Resistance of Acinetobacter baumannii Isolated from Hospitals in Southern Poland: ICU as a Risk Factor for XDR Strains. Microb Drug Resist. 2016;22(4):328-35. [DOI:10.1089/mdr.2015.0224] [PMID]

13. CLSI. Performance Standards for Antimicrobial Susceptibilly Testing, Clinical and Laboratory Standars Institute. Wayne, PA, USA; 2019.

14. Zeighami H, Valadkhani F, Shapouri R, Samadi E, Haghi F. Virulence characteristics of multidrug resistant biofilm forming Acinetobacter baumannii isolated from intensive care unit patients. BMC Infect Dis. 2019;19(1):1-9. [DOI:10.1186/s12879-019-4272-0] [PMID] [PMCID]

15. Al-Shamiri MM, Zhang S, Mi P, Liu Y, Xun M, Yang E, et al. Phenotypic and genotypic characteristics of Acinetobacter baumannii enrolled in the relationship among antibiotic resistance, biofilm formation and motility. Microb Pathog. 2021;155:104922. [DOI:10.1016/j.micpath.2021.104922] [PMID]

16. Mozafari H, Mirkalantari S, Sadeghi Kalani B, Amirmozafari N. Prevalence Determination of Virulence Related and Biofilm Formation Genes in Acinetobacter baumannii Isolates from Clinical Respiratory Samples in Imam Khomeini Hospital, Tehran, Iran in 2018. Iran J Med Microbiol. 2021;15(3):266-80. [DOI:10.30699/ijmm.15.3.266]

17. Almasaudi SB. Acinetobacter spp. as nosocomial pathogens: Epidemiology and resistance features. Saudi J Biol Sci. 2018;25(3):586-96. [DOI:10.1016/j.sjbs.2016.02.009] [PMID] [PMCID]

18. Asif M, Alvi IA, Rehman SU. Insight into Acinetobacter baumannii: pathogenesis, global resistance, mechanisms of resistance, treatment options, and alternative modalities. Infect Drug Resist. 2018(11):1249-60. [DOI:10.2147/IDR.S166750] [PMID] [PMCID]

19. Gonzalez-Villoria AM, Valverde-Garduno V. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen. J Pathog. 2016;2016:7318075. [DOI:10.1155/2016/7318075] [PMID] [PMCID]

20. Sarafan Sadeghi A, Ansari N, Khademi F, Mir Nejad R, Zamanzad B. Drug Resistance Patterns and Genotyping of Acinetobacter baumannii Strains Isolated from Patients Admitted to Shahrekord Teaching Hospitals Using REP-PCR. J Ardabil Univ Med Sci. 2019;19(1):30-40. [DOI:10.29252/jarums.19.1.30]

21. Shirmohammadlou N, Zeighami H, Haghi F, Kashefieh M. Resistance pattern and distribution of carbapenemase and antiseptic resistance genes among multidrug-resistant Acinetobacter baumannii isolated from intensive care unit patients. J Med Microbiol. 2018;67(10):1467-73. [DOI:10.1099/jmm.0.000826] [PMID]

22. SILVA A, Costa JS, Lima J, FARIAS FJ. Cavalcanti IM, Maciel MA. Investigation of the association of virulence genes and biofilm production with infection and bacterial colonization processes in multidrug-resistant Acinetobacter spp. Anais da Academia Brasileira de Ciências. 2021(93). [DOI:10.1590/0001-3765202120210245] [PMID]

23. Porbaran M, Habibipour R. Relationship between biofilm regulating operons and various β-Lactamase enzymes: analysis of the clinical features of infections caused by non-fermentative gram-negative bacilli (NFGNB) from Iran. J Pure Appl Microbiol. 2020;14(3):1723-36. [DOI:10.22207/JPAM.14.3.11]

24. Amin M, Navidifar TA-O, Shooshtari FS, Rashno M, Savari M, Jahangirmehr F, et al. Association Between Biofilm Formation, Structure, and the Expression Levels of Genes Related to biofilm formation and Biofilm-Specific Resistance of Acinetobacter baumannii Strains Isolated from Burn Infection in Ahvaz, Iran. Infect Drug Resist. 2019(12):3867-81. [DOI:10.2147/IDR.S228981] [PMID] [PMCID]

25. Tavakol M, Momtaz H, Mohajeri P, Shokoohizadeh L, Tajbakhsh E. Genotyping and distribution of putative virulence factors and antibiotic resistance genes of Acinetobacter baumannii strains isolated from raw meat. Antimicrob Resist Infect Control. 2018(1):1. [DOI:10.1186/s13756-018-0405-2] [PMID] [PMCID]

26. Fallah F, Noori M, Hashemi A, Goudarzi H, Karimi A, Erfanimanesh S, et al. prevalence of blaNDM, blaPER, blaVEB, blaIMP, and blaVIM Genes among Acinetobacter baumannii Isolated from Two Hospitals of Tehran, Iran. Scientifica. 2014;2014:245162. [DOI:10.1155/2014/245162] [PMID] [PMCID]

27. Aksoy MD, Çavuşlu Ş, Tuğrul HM. Investigation of Metallo Beta Lactamases and Oxacilinases in Carbapenem Resistant Acinetobacter baumannii Strains Isolated from Inpatients. Balkan Med J. 2015;32(1):79-83. [DOI:10.5152/balkanmedj.2015.15302] [PMID] [PMCID]

28. Mlynarcik P, Roderova M, Kolar M. Primer Evaluation for PCR and its Application for Detection of Carbapenemases in Enterobacteriaceae. Jundishapur J Microbiol. 2016;9(1):e29314. [DOI:10.5812/jjm.29314] [PMID] [PMCID]

29. Thummeepak R, Kongthai P, Leungtongkam U, Sitthisak S. Distribution of virulence genes involved in biofilm formation in multidrug resistant Acinetobacter baumannii clinical isolates. Int Microbiol. 2016;19(2):121-9.

30. Sung J. Molecular Characterization and Antimicrobial Susceptibility of Biofilm-forming Acinetobacter baumannii Clinical Isolates from Daejeon, Korea. Korean J Clin Lab Sci. 2018;50:100-9. [DOI:10.15324/kjcls.2018.50.2.100]

31. Monem S, Furmanek-Blaszk B, Łupkowska A, Kuczyńska-Wiśnik D, Stojowska-Swędrzyńska K, Laskowska E. Mechanisms protecting Acinetobacter baumannii against multiple stresses triggered by the host immune response, antibiotics and outside-host environment. Int J Mol Sci. 2020;21(15):5498-528. [DOI:10.3390/ijms21155498] [PMID] [PMCID]

32. Fallah A, Rezaee MA, Hasani A, Barhaghi MHS, Kafil HS. Frequency of bap and cpaA virulence genes in drug resistant clinical isolates of Acinetobacter baumannii and their role in biofilm formation. Iran J Basic Med Sci. 2017;20(8):849-55.

33. Bardbari AM, Arabestani MR, Karami M, Keramat F, Alikhani MY, Bagheri KP. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates. Microb Pathog. 2017;108:122-8. [DOI:10.1016/j.micpath.2017.04.039] [PMID]

34. Choi Alexis HK, Slamti L, Avci Fikri Y, Pier Gerald B, Maira-Litrán T. The pgaABCD Locus of Acinetobacter baumannii Encodes the Production of Poly-β-1-6-N-Acetylglucosamine, Which Is Critical for Biofilm Formation. J Bacteriol. 2009;191(19):5953-63. [DOI:10.1128/JB.00647-09] [PMID] [PMCID]

35. Pakharukova N, Tuittila M, Paavilainen S, Malmi H, Parilova O, Teneberg S, et al. Structural basis for Acinetobacter baumannii biofilm formation. Proc Natl Acad Sci. 2018;115(21):5558-63. [DOI:10.1073/pnas.1800961115] [PMID] [PMCID]

36. Farrow IJ, Wells G, Pesci E. Desiccation tolerance in Acinetobacter baumannii is mediated by the two-component response regulator BfmR. PloS One. 2018;13(10):e0205638. [DOI:10.1371/journal.pone.0205638] [PMID] [PMCID]