Iranian Journal of Medical Microbiology

Isolates tested

In a descriptive-analytical study from September 2019 to March 2020 at a Sina hospital in Hamadan, Iran, we analyzed all 36 isolates collected from hospitalized patients who were phenotypically identified by the referring clinical microbiology laboratories as Alcaligenes. We get the ethical approval letter from the institutional research ethics review committee of Hamadan University of medical sciences. (NO. IR.UMSHA.REC.1396.443).

Phenotypic profiling

The bacteria studied in this research were isolated from blood and urine samples of hospitalized patients in Sina hospital. To phenotypic identification, all isolates were grown on selective media such as SIM, TSI, MR, VP, Citrate, Urea agar, and MacConkey agar (Merck, Germany) and incubated at 37ºc for 24 hours. To confirmation the purity, the samples were examined by Gram staining. Phenotypic characteri-zations were performed on all isolates, using protocols for Gram-negative, non-fermentative bacteria such as motility tests, oxidative fermentation of glucose and lactose, Bile-esculin, DNase, Nitrate reduction, and Indole reactions. Clinical isolates approved by biochemical experiments were stored at -20 °C. Following the phenotypic and biochemical tests, we used the PCR test to more investigate accurately the detection and confirmation of the phenotypic results.

DNA extraction, PCR amplification, and DNA sequencing

Bacterial genomic DNA for PCR amplification was extracted by the boiling method as previously descry-bed (15). The NanoDrop spectrophotometer (Thermo Scientific™ 840274100) was used to determine the amount of extracted DNA. The purity of DNA (OD A260/280) was measured in ng/µl. The quality of the extracted DNA was assessed on 1% Agarose gel.
The PCR was performed in BioRad T100 PCR Thermocycler with AX and 77F-r gene-specific primers, to genetically confirm the phenotypically identified A. xylosoxidans and A. faecalis, respectively. The specific primers used for the amplification of the AX gene were AX-F 5̒̒ GCAGGAAAGAAA CGTCGC GGGT 3̒̒ and AX -R 5̒̒̒ ATTTCCATCTTTCTTTCCG 3̒. The 77F-r specific primers (77F-r-F 5̒ GGCGGACGGGTGAGTAATA 3̒ and 77F-r-R 5̒ CTGCAGATACCGTCAGCAGT 3̒) were also used to confirm A. faecalis (16). The PCR reaction mixture of 12.5 µl contained 1 µl of DNA template (20 ng), 0.5 µl of each primer (concentration of each primer was 0.5 µM), 6 µl of Taq DNA Polymerase Master Mix RED (amplicon, Denmark) and, 4.5 µl distilled water was used. The first PCR step was performed at 95°C for 3 min and was followed by 30 cycles of denaturation (95 °C for 1 min), annealing (55 °C and 58 °C for 1 min in annealing AX and 77F-r, respectively), and extension (72 °C for 1 min). The last step was performed at 72 °C for 5 min. Positive control (A clinical sample confirmed by sequencing) and negative control (Pseudomonas aeruginosa ATCC 27853) were utilized to avoid false-positive results. The amplified PCR products were analyzed using 2% agarose gels and stained with GelRed® nucleic acid stain.  An amplified PCR product corresponding to the expected size of AX and 77F-r genes was used for sequencing. Sequences obtained for each of the analyzed genes were assembled and compared to available sequences in Genbank, using the BLAST (Basic Local Alignment Search Tool) algorithm of the NCBI (National Center for Biotech-nology Information) (16).

Antimicrobial susceptibility assay

We performed the antimicrobial susceptibility tests for each isolate by the disc diffusion method (Kirby-Bauer). The results were interpreted as either sensitive, intermediate, or resistant according to the Clinical Laboratory Standards Institute (CLSI-2018) susceptibility breakpoints for non-fermenting gram-negative bacteria (17). Antibiotic discs (Mast (UK)), used for the tests included: ampicillin (AP10 ug), trimethoprim/sulfamethoxazole (TS25 ug), ciproflo-xacin (CIP5 ug), imipenem (IMI10 ug), Gentamicin (GM10 ug), Meropenem (MEM10 ug), Ceftazid-ime-(CAZ30 ug), ceftriaxone(CRO30 ug), piperacillin-/tazo-bactam (PTZ110 ug), ampicillin/sulbactam (SAM20 ug), cefepime (CPM30 ug).

Several studies have been conducted to evaluate the immunogenicity of various conjugates, including ALG-TT, ALG-SLNs, PLGA-ETA, ALG-DT, etc. In this study, for the first time, the immunogenic effect of ALG-ETA conjugate was investigated against P. aeruginosa infections.
 
 

Our findings showed that antitoxin A antibodies can play a greater protective effect than P. aeruginosa infections. This conjugated compound increases the level of anti-ALG IgG antibodies, and immunization with this type of conjugate can stimulate toxin A-neutralizing antibodies. T
 
 

None

 

This article is an independent study conducted with no organizational financial support.

 

Conflicts of Interest

The authors declared no conflict of interest.