year 15, Issue 4 (July - August 2021)                   Iran J Med Microbiol 2021, 15(4): 384-391 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Masoumi P, Mahmoodzadeh Hosseini H, Moosazadeh Moghaddam M, Keshavarz Lelekami A, Mohammadyari S, Mirhoseini S A. Clostridium Perfringens Toxin Types Associated with Meat: Review in Iran. Iran J Med Microbiol 2021; 15 (4) :384-391
URL: http://ijmm.ir/article-1-1312-en.html
1- Applied Microbiology Research Center, Systems Biology and Poisonings Institute, Baqiatallah University of Medical Sciences, Tehran, Iran
2- Applied Biotechnology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran
3- Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Islamic Azad University, Science and Research Branch, Tehran, Iran
4- Department of Food Hygiene, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Iran
5- Applied Microbiology Research Center, Systems Biology and Poisonings Institute, Baqiatallah University of Medical Sciences, Tehran, Iran , ali.mirh@gmail.com
Full-Text [PDF 549 kb]   (1372 Downloads)     |   Abstract (HTML)  (3404 Views)
Full-Text:   (1705 Views)
Introduction


Food poisoning is one of the most common health problems all over the world. It has been reported more in underdeveloped and third world countries due to their low levels of hygiene. Some bacteria cause food poisoning by producing toxins in food (1). Among all bacteria, Clostridium perfringens is one of the most important agents causing food poisoning due to its toxin production ability, short incubation time, and survivability in harsh environments. The clinical signs and symptoms can vary, but the most common signs are abdominal cramps, diarrhea, and to a less extent vomiting (2). Since C. perfringens cannot synthesize 13 required amino acids (out of the total 20), protein-rich food constitutes a favorable medium for this bacter-ium (3). Raw meat and chicken are the most common infection sources; however, this bacterial infection can also be transmitted from legumes (4). Thus, we focused on meat poisoning to produce more impor-tant and precise results. Indeed, C. perfringens is amo-ng the anaerobic, gram-positive, spore-forming bacte-ria that are environmentally widespread (5, 6).
Genes of C. perfringens encode more than 17 unique toxins, which can be categorized into five types of toxin (A-E) according to the existence of four different toxin genes: α (alpha), β (beta), ε (epsilon), and ι (iota) toxins. Alpha-toxin is encoded by the gene of cpa and all types of C. perfringens produce this toxin. Entero-toxin, encoded by cpe gene, is the main virulence factor implicated in food poisoning in humans (7,8). It was not a long time ago when it was suggested that this typing design should include types F and G, which encompass the Clostridium perfringens enterotoxin (CPE) and NetB toxin of C. perfringens, respectively. However, further studies are required before formally accepting this design. Even though the gene encoding α toxin is located on chromosomes, one can find cpe gene in both plasmid and chromosome. In compare-son, the genes of the remaining toxins are found on various plasmids of different size. The vehicles of food poisoning by C. perfringens are typically meat and its products (9-13).
Approximately 2–5% of all the isolates of C. perfringens, most of which belong to type A, generate cpe (14). One of the most frequently reported food poisoning pathogens in Europe, the United States, and Turkey is cpe-positive C. perfringens type A (13,15,16). Therefore, for a better comprehension of the epidemi-ology of C. perfringens infections, the identification of the toxin types of C. perfringens is vital, which can also help in a better development of preventive measures in practice. It is likely that contamination of meat products or meat dishes with insufficient cooking and high C. perfringens counts is the main reason for outbreaks. Meat products can be contaminated thro-ugh various routes. The most common way is the int-ernal route in animals after slaughtering, which manifests itself as a post mortem invasion. Besides, external sources like dirty hands, soil, water, animal skin, and processing equipment can be important sources of infection (16, 17). The test of neutralization of toxin is commonly employed in guinea pigs or mice for the typing of C. perfringens (18,19). Nonetheless, this detection technique is costly and time-consuming; therefore, as an alternative, the molecular techniques, such as polymerase chain reaction (PCR), have often been used most recently (20, 21).
This paper reviews the incidence of C. perfringens meat poisoning in Iran, considering the toxin types and their encoding genes. Moreover, detection methods, food safety concerns and prevention strategies are discussed.

Risk Factors for Food Poisoning
Meat and meat products are among the most popular foods worldwide, and food poisonings are sometimes accompanied by meat poisoning. Cperfri­ngens is an obligate anaerobic bacterium, and hence it prefers to grow at a deficient level or under oxygen-free conditions. It is found in deep musculature due to this trait. Since humans are susceptible to this bacteri-um’s food poisoning, risk factors that compromise food safety should be discussed and established. Symptoms can vary from diarrhea to even death, but fatalities are rare, occurring in <0.03% of cases (22). Death is usually caused by dehydration in age extremities, i.e., very young or very older people, and in immunocompromised people (3). Based on the prevalence, the risk of contaminated and illness-causing food can be categorized as high or low. High-risk sources include beef and poultry, and they acco-unt for most of the outbreaks. Low-risk sources include seafood and sausage (23). Although preven-tive measures have already been taken against this pathogenic agent, C. perfringens is still a significant cause of Iran’s food-borne infections.
Enterotoxaemia

C. perfringens enterotoxin (CPE) is the most vital virulence factor causing human gastrointestinal (GI) diseases among the isolates type A. However, a very small percentage (<5%) of all the C. perfringens generate this toxin (24). The role that C. perfrin-gens enterotoxin plays in food poisoning has been entrenched. C. perfringens food poisoning symptoms comprise severe cramps of the abdomen and watery diarrhea. The onset of these signs commonly starts 6 to 24 hours after eating contaminated foods with C. perfringens at large numbers. Usually, the disease does not last long and diminishes in less than 24 hours. Symptoms of less severance may persist for 1 or 2 weeks. However, C. perfringens enterotoxin produc-tion is related to the process of sporulation, which happens in the small intestine after consuming a large number of temperature-abused foods (25). Numerous surveys of C. perfringens incidence have been repor-ted in foods (26), but not many of them included fish (27,28), that means most of the outbreaks are due to meat products. Few non-outbreak isolates contain the cpe enterotoxin gene of C. perfringens (29,30). Between 1983 and 2002, this organism was ranked second and third in terms of confirmed cases and foodborne outbreaks of bacterial cause in the United States, respectively (31). In addition, Lund et al. (2002) reported a single-component enterotoxin (38). The necrotic enteritis that it caused is similar to that caused by the toxin of C. perfringens, but it is rarely reported.
 

 

Materials and Methods

To detect six toxin genes: cpa (alphatoxin), cpb (beta toxin), etx (epsilon toxin), cpiA (iota toxin), cpe (enterotoxin), and netB (NetB) with PCR, the DNA is extracted from isolates by the boiling method (32, 33). The lethality assay for mouse and skin test for guinea pig, which are conventionally used for the typing of C. perfringens, are time-consuming and costly and raise ethical concerns du to use of laboratory animals. Nowadays, researchers usually adopt molecular meth-ods, including microarray and PCR, especially real-time PCR (34-37). More to the point, various protocols of PCR have been evolved for the identification of the cpa, cpb, etx, iA, cpe, cpb2, and netB genes that encode the generation of toxins, including α, β, ε, ι, enterotoxin, β2, and NetB (19-34). Multiplex PCR, one of these protocols, enables the rapid, unlabored and simultaneous detection of multiple genes at lower costs. By virtue of these advantages, multiplex PCR is among the typically employed molecular approaches for C. perfringens typing, and some primers are used for the detection of these toxins (Table 1).


Table 1. Nucleotide sequences of commonly used multiplex PCR primers for detecting the toxin gene of C. perfringens (8,14,41).

Toxin/gene Primer Sequence (5'-3') Fragment length
 
α/cpa
CPALPHATOX-F GCTAATGTTACTGCCGTTGA 324 bp
CPALPHATOX-R CCTCTGATACATCGTGTAAG
 
β/cpb
CPBETATOX-F GCGAATATGCTGAATCATCTA 196 bp
CPBETATOX-R GCAGGAACATTAGTATATCTTC
 
ε/etx
CPETOXIN-F GCGGTGATATCCATCTATTC 655 bp
CPETOXIN-R CCACTTACTTGTCCTACTAAC
 
ι/iA
CPIOTA-F ACTACTCTCAGACAAGACAG 446 bp
CPIOTA-R CTTTCCTTCTATTACTATACG
 
CPE/cpe
CPENTEROTOK-F GGAGATGGTTGGATATTAGG 233 bp
CPENTEROTOK-R GGACCAGCAGTTGTAGATA
 
β2/cpb2
CPBETA2TOK-F AGATTTTAAATATGATCCTAACC 567 bp
CPBETA2TOK-R CAATACCCTTCACCAAATACTC
 
NetB/netB
JRP6656 CTTCTAGTGATACCGCTTCAC 738 bp
JRP6655 CGTTATATTCACTTGTTGACGAAAG

 

There are commercially available assay kits to detect the toxins; however, they determine only one comp-onent of each complex and positive isolates can be considered only potentially enterotoxigenic. An over-view of the toxins detection methods is shown in Table 2. Besides, PCR primers specific for the enterotoxin genes and the cereulide gene (ces) have been deve-loped recently (39). Furthermore, multiplex PCR assay provides a rapid and straightforward method for genotyping C. perfringens isolates (40). An overview of the toxins and their prevalence is shown in Tables 3-5.


Table 2. Overview of C. perfringens toxins detection methods

Method Advantage Limitation Reference
ELISA * High sensitivity
* High specificity
* Rapid detection
* Easily adaptable
* Some may take several days
* Fecal material inhibits sensitivity
* serological cross-reaction
42,43
Nucleic acid amplification * High sensitivity
* High specificity
* Cannot replace traditional reference standards as a single method 44
Immunochromatographic assay * High sensitivity
* Rapid detection (20 minutes)
Not described 45
18F labelling * Sufficient stability in plasma * Being subject to liver uptake
* Rapid metabolic degradation
46
Electrochemiluminescence * High selectivity
* High sensitivity
* Inaccurate at high temperatures 47


Table 3. Overview of C. perfringens types, toxins and genes that cause diseases in humans and animals (8, 48) 

C. perfringens type Toxin C. perfringens toxin gene Diseases
Human Animal
A α cpa
cpa, cpb
cpa, cpe
cpa, cpe, cpb2
Gangrene
Food poisoning
Antibody associated diarrhea, sporadic diarrhea
Diarrhea (dogs, pigs, etc.)
Necrotic enteritis (Fowl)
B α,β,ε cpa, cpb, etx
cpa, cpb, etx, cpb2
- Dysentery (lambs)
Enterotoxaemia (sheep)
C α,β cpa, cpb
cpa, cpb, cpb2
cpa, cpb, cpb2, cpe
cpa, cpb, cpe
Enteritis necroticans (pigbel) Necrotic enteritis (piglets, foals, etc.)
Acute enterotoxaemia (adult sheep)
D α, ε cpa, etx
cpa, etx, cpb2
cpa, etx, cpb2, cpe
cpa, etx, cpe
- Enterotoxaemia (goats, sheep, etc.)
E α, ι cpa, iA - Enterotoxaemia (calves and rabbits)
F α, CPE cpa, cpe Food poisoning, Antibody associated diarrhea -
G α, NetB cpa, netB - Necrotic enteritis (chickens)


Table 4. Prevalence of different C. perfringens toxinotypes in food (by type) (%) in Iran 

 
Province
 
Meat type
Toxinotypes  
Year of publication
 
Ref
Type A Type B Type C Type D
α α, β, ε α, β α, ε
Chaharmahal and Bakhtiari Chicken 42 - - - 2017 49
Kerman Ostrich 100 0 0 0 2014 50
Razavi Khorasan Beef 81 4 4 4 2015 51
Alborz Mutton 63.6 25 21.4 53.3 2016 52
Razavi Khorasan Chicken 29.03 - 70.96 - 2015 53


Table 5. Prevalence of different C. perfringens toxinotypes in food (by gene) (%) in Iran

Province Meat type Gene Year of publication Ref
cpa cpb cpe cpi etx cpb2 netB
Chaharmahal and Bakhtiari Beef 75.5 50 62 37.5 25 - - 2017 54
Razavi Khorasan Chicken 100 100 - - - - 83.33 2014 55
Kerman Chicken - - - - - - 17.78 2016 56
Razavi Khorasan Beef 81 18 - - - - - 2015 53
Alborz Mutton - - 38.3 - - - - 2016 52
Razavi Khorasan Chicken - - 25 - - - - 2015 51

 

Discussion

Recently, there have been some significant develop-ments in illuminating the spore germination mecha-nism of C. perfringens, which led to the detection and delineation of appropriate germinants and their receptors of C. perfringens FP and NFB strains’ spores (57, 58). Despite the variations in the inclination of germinants among the strains, still in some germin-ants such as AK or l-cysteine, the germination of spores can be induced in a broad extent of C. perfringens strains (57, 60). Such insights have been the cause of evolving innovative strategies concerning the spore germination induction followed by dest-roying the germinated spores with mild treatments afterwards (60-63). Some examples are as follows. (i) When AK germinant was used in meat products before high hydrostatic pressure (HHP) treatment (586 MPa) at high temperature (73°C for 10 min), the procedure significantly destroyed the spores of C. perfringens in meat-contained feed (62). (ii) Chemical preservatives, e.g., nisin, sorbate, and benzoate, at permissive levels efficiently halted the proliferation of germinated C. perfringens spores in rich environment. Nevertheless, to achieve significant inhibitory effects against the spores of C. perfringens, higher levels of chemicals were needed to be inoculated into chicken meat (60, 64). (iii) Provoking spore germination significantly increased the sporicidal activity of typical disinfectants against C. perfringens FP spores attached to stainless steel chips (57). This inactivation strategy based on germination induction was also efficient in destroying spores from other Clostridium species (65.66). Collect-ively, provoking spore germination before inactivation treatment renders a unique strategy to improve the sporicidal power for Clostridium spores.
Moreover, other strategies are available for the control and inactivation of the Clostridium toxins, includeing physical approaches, which consist of ther-mal and pressure treatments and chemical agents, e.g., nitrate, nitrite, and organic acids (67). The latter consists of lactic acid, acetic acid, and phosphates (67). Vegetative cells of C. perfringens can be killed via devastating physical conditions. Still the difficult part of removing C. perfringens from food is their spores, which can be eliminated by adding environmental stress factors including ozone (69), ultrasound (70), and gamma radiation (71).
In addition, two types of vaccines have been establi-shed to be employed against this bacterium, which are the gas gangrene vaccine and epsilon toxin vaccine (68).


 

Conclusion

C. perfringens is considered one of the most com-mon food poisoning agents, especially in the meat industry. There are some published reports every year indicating the outbreaks of the C. perfringens food poisoning that have even caused death in some cases. Therefore, effective methods should be used to detect and prevent the food poisoning caused by such bacterium. PCR-based techniques can be a very reli-able tool for detecting the pathogen, and there also exist several helpful strategies such as germina-tion-induced inactivation, training the consumer about the correct handling of food, proper prepara-tion of food, and food storage in order to avoid this pathogenic agent. Besides, surveillance plays a key role in the effectiveness of the prevention strategies before food is delivered to the consumer.


 

Acknowledgements

The authors thank all those who helped them writing this article.


 

Conflicts of Interest

The authors declared no conflict of interest. 


 

Type of Study: Systematic Review | Subject: Food Microbiology
Received: 2021/04/11 | Accepted: 2021/06/5 | ePublished: 2021/08/16

References
1. Ali A, Parisi A, Conversano MC, Iannacci A, Emilio FD, Mercurio V, et al. Food-Borne Bacteria Associated with Seafoods: A Brief Review. J food Qual Hazards Control. 2020; 7:4-10. [DOI:10.18502/jfqhc.7.1.2446]
2. Centers for Disease Control and Prevention (CDC). Fatal foodborne Clostridium perfringens illness at a state psychiatric Hospital-Louisiana. Morb Mortal Wkly Rep. 2010;61(32):605.
3. Brynestad S, Granum PE. Clostridium Perfringens and foodborne infections. Int J Food Microbiol. 2002; 74:195-202 [DOI:10.1016/S0168-1605(01)00680-8]
4. Cevallos-Cevallos JM, Akins ED, Friedrich LM. Growth of Clostridium Perfringens during cooling of refried beans. J food Protect. 2012;75(10):1783-90. [DOI:10.4315/0362-028X.JFP-12-088] [PMID]
5. Jabbari AR, Afshari FS, Esmaelizad M. Molecular typing of toxigenic Clostridum perfringens isolated from sheep in Iran. Arch Razi Inst. 2011; 66(2):81-6.
6. Razmyar J, Kalidari GA, Tolooe A. Genotyping of Clostridium perfringens isolated from healthy and diseased ostriches (Struthio camelus). Iran J Microbiol. 2014;6(1):31.
7. Petit L, Gibert M, Popoff MR. Clostridium perfringens: toxinotype and genotype. Trends Microbiol. 1999; 7:104-110. [DOI:10.1016/S0966-842X(98)01430-9]
8. Rood JI, Adamsa V, Lacey J, Dena Lyrasa D, Bruce A, McClane BA, Stephen B, et al. Expansion of the Clostridium Perfringens toxin-based typing scheme. Anaerobe, 2018;53: 5-10. [DOI:10.1016/j.anaerobe.2018.04.011] [PMID] [PMCID]
9. Hatheway CL. Toxigenic clostridia. Clin Microbiol Rev. 1990; 3:66-98. [DOI:10.1128/CMR.3.1.66] [PMID] [PMCID]
10. Ridell J, Bjo¨rkroth J, Eisgru¨ber H. Prevalence of the enterotoxin gene and clonality of Clostridium perfringens strains associated with food-poisoning outbreaks. Journal of Food Protection. 1998; 61:240-243. [DOI:10.4315/0362-028X-61.2.240] [PMID]
11. Hatakka M, Halonen H. Foodborne and Waterborne Outbreaks in Finland in 1999. National Food Administration Research Notes. 2000;7.
12. Eisgruber H, Hauner G. Minced beef heart associated with a Clostridium perfringens food poisoning in a Munich old people's home. J Food Saf Food Qual. 2001;52, 63-6.
13. MP Doyle, LR Beuchat, TJ Montville, eds. Food Microbiology: Fundamentals and Frontiers. 2nd ed. Washington, DC: ASM Press, 2001.
14. Songer JG, Meer RM. Genotyping of Clostridium perfringens by polymerase chain reaction is a useful adjunct to diagnosis of clostridial enteric disease in animals. Anaerobe. 1996; 2, 197- 203. [DOI:10.1006/anae.1996.0027]
15. Cakmak O, Ormanci FSB, Tayfur M. Presence and contamination level of Clostridium perfringens in raw frozen ground poultry and poultry burgers. Turk J Vet Anim Sci. 2006; 30,101-105.
16. Hughes C, Gillespie IA, O'Brien SJ. Foodborne transmission of intestinal disease in England and Wales, 1992-2003. Food Control. 2007; 18, 766-72. [DOI:10.1016/j.foodcont.2006.01.009]
17. Satio M. Production of enterotoxin by C. perfringens derived from humans, animals, foods and the natural environment in Japan. J Food Protect. 1990; 53:115-8. [DOI:10.4315/0362-028X-53.2.115] [PMID]
18. Stern DH, Batty I. Pathogenic Clostridia 1st ed. Butterworth. London, U.K. 1975.
19. McDonel JL. Toxins of Clostridium perfringens types A, B, C, D, and E. In pharmacology of Bacterial toxins ed., Dorner, F. and Drews, H. 1986; 477-517.Oxford: pergamon press.
20. Baums CG, Schotte U, Amtsberg G. Diagnostic multiplex PCR for toxin genotyping of C. perfringens isolates. Vet Microbiol. 2004; 100(1-2):11-16. [DOI:10.1016/S0378-1135(03)00126-3]
21. Chon JW, Park JS, Hyeon JY, Park C, Song KY, Hong KW, et al. Development of Real-Time PCR for the Detection of Clostridium perfringens in Meats and Vegetables. J Microbiol Biotechnol. 2012; 22:530-4. [DOI:10.4014/jmb.1107.07064] [PMID]
22. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, et al. Foodborne illness acquired in the United States-major pathogens. Emerg Infect Dis. 2011; 17:7-15. https://doi.org/10.3201/eid1707.110572 https://doi.org/10.3201/eid1701.P21101 [DOI:10.3201/eid1701.P11101] [PMID]
23. Crouch E, Golden N. A risk assessment for Clostridium perfringens in ready-to-eat and partially cooked meat and poultry products. Retrieved June. 2005; 24:2010.
24. Heikinheimo A, Lindström M, Korkeala H. Enumerationand isolation of cpe-positive Clostridium perfringensspores from feces. J Clin Microbiol. 2004; 42, 3992-7. [DOI:10.1128/JCM.42.9.3992-3997.2004] [PMID] [PMCID]
25. Labbe R, Juneja V. Foodborne Infections and Intoxications: Chapter 6. Clostridium perfringens Gastroenteritis (Food Science and Technology, Clostridium perfringens gastroenteritis, 3rd ed. New York: Elsevier; 2006. [DOI:10.1016/B978-012588365-8/50008-6] [PMID]
26. Labbe, R. Guide to Foodborne Pathogens: Clostridium perfringens. 2001; 191-234.
27. Hobbs G, Cann D, Wilson, B. The incidence of organisms of the genes Clostridium in vacuum-packed fish in the United Kingdom. J Appl Bacteriol.1965; 28: 265-70. [DOI:10.1111/j.1365-2672.1965.tb02151.x] [PMID]
28. Taniguti T, Zenitani B. Incidence of Clostridium perfringens in fish. I. On the application of LAS medium to detection of Clostridium perfringens. J Food Hyg Soc Jpn. 1969; 10:199-203. [DOI:10.3358/shokueishi.10.199]
29. Lin YT, Labbe R. Enterotoxigenicity and genetic relatedness of Clostridium perfringens isolates from retail foods in the United States. Appl Environ Microbiol. 2003; 69:1642-6. [DOI:10.1128/AEM.69.3.1642-1646.2003] [PMID] [PMCID]
30. Weber D, Saviteer S, Rutala W. In vitro susceptibility of Bacillus spp. to selected antimicrobial agents. Antimicrob Agents Chemother. 1998; 32:642-5. [DOI:10.1128/AAC.32.5.642] [PMID] [PMCID]
31. Lynch M, Painter J, Woodruff R. Surveillance for Foodborne-Disease Outbreaks United States, 1998-2002. Surveill Summar. 2006; 55(SS10);1-34.
32. Zhang T, Luo Q, Chen Y, Li T, Wen G, Zhang R, et al. Molecular epidemiology, virulence determinants and antimicrobial resistance of Campylobacter spreading in retail chicken meat in Central China. Gut Pathog. 2016; 8:48. [DOI:10.1186/s13099-016-0132-2] [PMID] [PMCID]
33. Gkiourtzidis K, Frey J, Bourtzi-Hatzopoulou E. PCR detection and prevalence of alpha-, beta-, beta 2-, epsilon-, iota- and enterotoxin genes in Clostridium perfringens isolated from lambs with clostridial dysentery. Vet Microbiol. 2001;82: 39-43. [DOI:10.1016/S0378-1135(01)00327-3]
34. Meer RR, Songer JG. Multiplex polymerase chain reaction assay for genotyping Clostridium perfringens. Am J Vet Res. 1997; 58:702-5.
35. Miwa N, Nishina T, Kubo S, et al. Most probable numbers of enterotoxigenic Clostridium perfringens in intestinal contents of domestic livestock detected by nested PCR. J Vet Med Sci; 1997; 59:557-60. https://doi.org/10.1292/jvms.59.89 [DOI:10.1292/jvms.59.557]
36. Al-Khaldi SF, Myers KM, Rasooly A. Genotyping of Clostridium perfringens toxins using multiple oligonucleotide microarray hybridization. Mol Cell Probes. 2004; 18:359-67. [DOI:10.1016/j.mcp.2004.05.006] [PMID]
37. Albini S, Brodard I, Jaussi A. Real-time multiplex PCR assays for reliable detection of Clostridium perfringens toxin genes in animal isolates. Vet Microbiol. 2008; 127:179-85. [DOI:10.1016/j.vetmic.2007.07.024] [PMID]
38. Lund T, DeBuyser M, Granum PE. A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol. 2000; 38:254-61. [DOI:10.1046/j.1365-2958.2000.02147.x] [PMID]
39. Ehling-Schulz M, Vukov N, Schulz A. Identification and partial characterization of the non-ribosomal peptide synthetase gene responsible for cereulide production in emetic Bacillus cereus. Appl Environ Microbiol. 2005; 71:105-14. [DOI:10.1128/AEM.71.1.105-113.2005] [PMID] [PMCID]
40. Miyamoto K, Wen Q, Bruce A. Multiplex PCR Genotyping Assay That Distinguishes between Isolates of Clostridium perfringens Type A Carrying a Chromosomal Enterotoxin Gene (cpe) Locus, a Plasmid cpe Locus with an IS1470-Like Sequence, or a Plasmid cpe Locus with an IS1151 Sequence. J Clin Microbiol. 2004; 42(4): 1552-8. [DOI:10.1128/JCM.42.4.1552-1558.2004] [PMID] [PMCID]
41. Garmory HS, Chanter N, French NP. Occurrence of Clostridium perfringens b2-toxin amongst animals, determined using genotyping and subtyping PCR assays. Epidemiol Infect. 2000; 124:61-7 [DOI:10.1017/S0950268899003295] [PMID] [PMCID]
42. McClane BA, and Strouse RJ. Rapid detection of Clostridium perfringens type A enterotoxin by enzyme-linked immunosorbent assay. J Clin Microbiol. 1984; 19(2), 112-5. [DOI:10.1128/jcm.19.2.112-115.1984] [PMID] [PMCID]
43. Olsvik O, Granum PE, and Berdal BP. Detection of Clostridium perfringens type A enterotoxin by ELISA. Acta Pathol Microbiol Immunol Scand Sect B. 1982; 90:445-7. [DOI:10.1111/j.1699-0463.1982.tb00144.x] [PMID]
44. Chen K, Ahmed S, Sheng YJ, et al. Diagnostic Accuracy of Nucleic Acid Amplification Based Assays for Clostridium perfringens Associated Diseases: A Systematic Review and Meta-analysis. J Clin Microbiol, 2020; 24;58(9): e00363-20 [DOI:10.1128/JCM.00363-20]
45. Féraudet-Tarisse C, Mazuet C, Pauillac S, Krüger M, Lacroux C, Popoff MR, et al. Highly sensitive sandwich immunoassay and immunochromatographic test for the detection of Clostridial epsilon toxin in complex matrices. Plos one, 2017; 12(7), e0181013. [DOI:10.1371/journal.pone.0181013] [PMID] [PMCID]
46. Löser R, Bader M, Kuchar M, Wodtke R, Lenk J, Wodtke J, et al. Synthesis, 18 F-labelling and radiopharmacological characterisation of the C-terminal 30mer of Clostridium perfringens enterotoxin as a potential claudin-targeting peptide. J Amino Acids, 2019; 1(2), 219-44. [DOI:10.1007/s00726-018-2657-9] [PMID]
47. Jiang D, Liu F, Liu C. Induction of an electrochemiluminescence sensor for DNA detection of Clostridium perfringens based on rolling circle amplification. Anal Methods, 2014; 6(5), 1558-62. [DOI:10.1039/C3AY41961D]
48. Uzal FA, Vidal JE, McClane BA, et al. Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. Open Toxinol J. 2010; 2: 24-42. [DOI:10.2174/1875414701003020024] [PMID] [PMCID]
49. Doosti A, Pasand M, Mokhtari-Farsani A, et al. Prevalence of Clostridium perfringens type a isolates in different tissues of broiler chickens. Bulg J Vet Med. 2017; 1:20(1). [DOI:10.15547/bjvm.919]
50. Zandi E, Mohammadabadi MR, Ezzatkhah M. Typing of Toxigenic Isolates of Clostridium perfringens by Multiplex PCR in Ostrich. Iran J Appl Anim Sci. 2014; 1:4(4).
51. Afshari A, Jamshidi A, Razmyar J, et al. Molecular typing of Clostridium perfringens isolated from minced meat. Iran J Vet Sci Technol.2015;7(1):32-9.
52. Jabbari AR, Esmaelizad M, Samimi F. Identification of enterototxin harboring gene among Clostridium perfringens isolates with different toxin types in Iran. Iran J Vet Med. 2016;10(3):165-72.
53. Afshari A, Jamshidi A, Razmyar J, Rad M. Genotyping of Clostridium perfringens isolated from broiler meat in northeastern of Iran. Vet Res Forum. 2015;6(4) 279.
54. Shakerian A, Rahimi E, Mesbah J, et al. Molecular Detection of Clostridium Perfringens in Some Raw Animal Food Origin Products in Shahrekord. J Paramed Sci. 2017;11(4): 391-9.
55. Poursoltani M, Mohsenzadeh M, Razmyar J. Toxinotyping of Clostridium perfringens strains isolated from packed chicken portions. Iran J Med Microbiol. 2014; 10;8(1):9-17.
56. Ezatkhah M, Alimolaei M, Shahdadnejad N. The Prevalence of netB Gene in Isolated Clostridium perfringens from organic broiler farms suspected to necrotic enteritis. International J Enteric Pathog. 2016; 16;4(3):3-5667. [DOI:10.15171/ijep.2016.03]
57. Paredes-Sabja D, Torres JA, Setlow P, et al. Clostridium perfringens spore germination: characterization of germinants and their receptors. J Bacteriol. 2008; 190:1190-201. [DOI:10.1128/JB.01748-07] [PMID] [PMCID]
58. Banawas S, Paredes-Sabja D, Korza G, Li Y, Hao B, Setlow P, et al. The Clostridium perfringens germinant receptor protein GerKC is located in the spore inner membrane and is crucial for spore germination. J Bacteriol. 2013; 195:5084-91. [DOI:10.1128/JB.00901-13] [PMID] [PMCID]
59. Udompijitkul P, Alnoman M, Banawas S. et al. New amino acid germinants for spores of the enterotoxigenic Clostridium perfringens type A isolates. Food Microbiol. 2014; 44:24-33. [DOI:10.1016/j.fm.2014.04.011] [PMID]
60. Alnoman M, Udompijitkul P, Paredes-Sabja D, et al. The inhibitory effects of sorbate and benzoate against Clostridium perfringens type A isolates. Food Microbiol, 2015; 48:89-98. [DOI:10.1016/j.fm.2014.12.007] [PMID]
61. Udompijitkul P, Paredes-Sabja D, Sarker MR. Inhibitory effects of nisin against Clostridium perfringens food poisoning and nonfood-borne isolates. J Food Sci. 2012; 77:51-6. [DOI:10.1111/j.1750-3841.2011.02475.x] [PMID]
62. Akhtar S, Paredes-Sabja D, Torres JA, et al. Strategy to inactivate Clostridium perfringens spores in meat products. Food Microbiol. 2009; 26:272-7. [DOI:10.1016/j.fm.2008.12.011] [PMID]
63. Udompijitkul P, Alnoman M, Paredes-Sabja D, et al. Inactivation strategy for Clostridium perfringens spores adhered to food contact surfaces. Food Microbiol, 2103; 34:328-36. [DOI:10.1016/j.fm.2013.01.003] [PMID]
64. Delves-Broughton J. Nisin as a food preservative. Food Aust. 2005; 57:525-7. [DOI:10.1201/9781420028737.ch7]
65. Nerandzic MM, Donskey CJ. Triggering germination represents a novel strategy to enhance killing of Clostridium difficile spores. PLoS One. 2010; 5: e12285. [DOI:10.1371/journal.pone.0012285] [PMID] [PMCID]
66. Ishimori T, Takahashi K, Goto M, Nakagawa S, Kasai Y, Konagaya Y, et al. Synergistic effects of high hydrostatic pressure, mild heating, and amino acids on germination and inactivation of Clostridium sporogenes spores. Appl Environ Microbiol. 2012; 78:8202-7. [DOI:10.1128/AEM.02007-12] [PMID] [PMCID]
67. Talukdar PK, Udompijitkul P, Hossain A. Inactivation Strategies for Clostridium perfringens Spores and Vegetative Cells. Appl Environ Microbiol. 2016; 83(1), e02731-16. [DOI:10.1128/AEM.02731-16] [PMID] [PMCID]
68. Titball RW. Clostridium perfringens vaccines. Vaccine. 2009 Nov 5;27 Suppl 4: D44-7. [DOI:10.1016/j.vaccine.2009.07.047] [PMID]
69. Novak JS, Yuan JT. Increased inactivation of ozone-treated Clostridium perfringens vegetative cells and spores on fabricated beef surfaces using mild heat. J Food Prot. 2004; 67:342-6. [DOI:10.4315/0362-028X-67.2.342] [PMID]
70. Evelyn SFV. Use of power ultrasound to enhance the thermal inactivation of Clostridium perfringens spores in beef slurry. Int J Food Microbiol. 2015; 206(3):17-23. [DOI:10.1016/j.ijfoodmicro.2015.04.013] [PMID]
71. Gombas DE, Gomez RF. Sensitization of Clostridium perfringens spores to heat by gamma radiation. Appl Environ Microbiol. 1978; 36:403-7. [DOI:10.1128/aem.36.3.403-407.1978] [PMID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2025 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc