year 14, Issue 5 (September - October 2020)                   Iran J Med Microbiol 2020, 14(5): 441-459 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Ghaderi H, Shiri Malekabad E, Vahidi M, Dadashi A. Evaluation of Genotypic and Phenotypic Biofilm Formation by Staphylococcus aureus Isolated from Clinical Samples and Their Association with Antimicrobial Resistance. Iran J Med Microbiol 2020; 14 (5) :441-459
URL: http://ijmm.ir/article-1-1140-en.html
1- Ph.D. Student, Department of Bacteriology, School of Veterinary Science, Shiraz University, Shiraz. Iran
2- Instructor, Department of Biostatistics, Army Medical University (AJA), Tehran, Iran.
3- Assistant Professor, Department of Laboratory Sciences, Army Medical University (AJA), Tehran, Iran.
4- Assistant Professor, Infectious Disease Department, AJA University of Medical Sciences, Tehran, Iran. , drdadashialireza@gmail.com
Full-Text [PDF 857 kb]   (2317 Downloads)     |   Abstract (HTML)  (4839 Views)
Full-Text:   (2855 Views)
Introduction

Biofilm is the aggregation of bacteria embedded in an extracellular matrix that can create on both abiotic and biotic surfaces (1). This layer provides ideal conditions for bacteria to grow in unstable environments. The most important features of biofilm are bacterial survival in extreme environmental conditions, role in pathogenicity and creating chronic diseases, strengthening drug resistance through antibiotic impermeability in the polymeric matrix, facilitate gene transfer through conjugation and increase genetic mutations due to these bacterial connections, development of new genotypic strains by mutation within the biofilm and activation of genes that they are responsible for bacterial virulence (2, 3). S. aureus is one of the pathogens that can cause disease in humans and animals (4). This bacterium is the cause of many diseases in humans, included skin infections, acute and invasive infections such as pneumonia, soft tissue and bone infections, heart valve infections and lethal sepsis. It is one of the most important causes of bacteremia and is responsible for 20-40% of deaths (5, 6). In addition to resistance, this bacterium has the ability to produce various pathogenic factors such as toxins, surface antigens, extracellular enzymes and biofilm production (6, 7).
In S. aureus, the pathogenicity of the biofilm is very important. The presence of this layer is encoded by a structural operon called intra cellular adhesin (ica), which has different gene locus including icaA, icaD, icaB and icaD (8,9, 10). The icaA gene is a primary inducer for start biofilm production. It is activated by the presence of UDP-N-acetyl glucosamine and is the only ica gene that has transferase properties. The IcaD protein is a messenger (chaperone) for other genes in this locus that helps the icaA gene, activates certain enzymes to express the icaC and icaD genes. When the icaA and icaD genes start cooperation, biofilm production increases 20 times (9, 10). The icaC gene communicates between the inside and outside of the bacterial cytoplasmic membrane, that it communicates the IcaD on the inside of the cytoplasmic membrane to the IcaB on the outside. The IcaB is the extracellular protein and cause the superficial association of the bacterium with intercellular adhesion polysaccharide (IAP). One of the factors that increases the expression of this operon is the relationship between IcaB and IPA, that more correlation leads to more biofilm production (11).
Biofilms in hospital environments, that are considered as a reservoir of infection transmission, responsible for causing 65% of nosocomial infections (12). Biofilm binds bacteria to surfaces and other hospital instruments and in this way, to provide the ground for infection in hospitalized people and users of these medical devices (13). In order to prevent the formation of biofilm and subsequent microbial resistance, increased hospitalization, increased costs, and increased mortality (especially in antibiotic-resistant S. aureus); proper use of antibiotics (under the supervision) as well as arbitrarily use of drugs and antimicrobial compounds, regular evaluation of resistance and expression of related genes at the hospital can greatly reduce the incidence of these problems.
Due to the high prevalence of nosocomial infections caused by S. aureus and also the spread of factors that increase antibiotic resistance, the present study aimed to evaluate the genotypic and phenotypic biofilm formation by S. aureus isolated from clinical samples and their association with antimicrobial resistance.


 

Materials and Methods

This descriptive cross-sectional study from Dec 2019 to Sep 2019 was conducted in the School of Paramedical Sciences, AJA University of Medical Sciences. The present study investigated by the ethics committee of the AJA University of Medical Sciences and approved with the code IR.AJAUMS.REC.1397.087. Using the formula for calculating the sample size and according to the results of similar studies (3, 10), 200 samples were calculated.
A total of 200 clinical samples from 63 patients admitted to different wards of AJA hospitals in Tehran were collected. Samples included blood (63 samples), urine (63), catheter (23 samples), discharge (17), ulcers (16 samples), sputum (12 samples), and nasal swabs (6 samples) which were referred to the paramedical faculty of the AJA University of Medical Sciences under sterile conditions. Inclusion criteria to study were included hospitalization in different wards of the hospital and long-term treatment with various antibiotics, and exclusion criteria were included outpatient treatment (no hospitalization) and no long-term use of antibiotics.
The samples were first cultured on blood Agar medium and incubated for 24h at 37°C. After observing the colonies, standard biochemical tests were performed to confirm the isolates including catalase test, Gram-staining, and then bacterial culture on mannitol salt agar media (mannitol fermentation test), Baird-Parker agar (formation of black colonies with clear and opaque halos), DNase and coagulase tests (14).

Antimicrobial Susceptibility Test
This test performed by Müller–Hinton agar (MHA) using the standard antibiotic disk including penicillin (10 IU), ciprofloxacin (5 μg), chloramphenicol (30 μg), gentamicin (10 μg), doxycycline (30 μg), Tetracycline (30 μg), clindamycin (2 μg), cotrimoxazole (25 μg), ampicillin (15 μg), erythromycin (15 μg), cephalothin (30 μg) and cefoxitin (30 μg), purchased from HiMedia company )Mumbai, India(. (10, 14). The isolates were further screened for methicillin resistance by the cefoxitin disk (15). In these tests, S. aureus ATCC 33591 was used as a positive control. The results exegesis conducted using Clinical and Laboratory Standards Institute guidelines (16).

Phenotypic Evaluation of Biofilm Producing Strains
Congo red and a modified microtiter plate (MTP) assay were used to identify biofilm-producing strains. Confirmed isolates were cultured on brain heart infusion (BHI) agar medium containing 0.8 g/L Congo red and 36 g/L sucrose. After 24h of incubation at 37°C, black colonies as strong biofilms, dark red colonies as weak biofilms and light red colonies as negative biofilm strains were considered (17).
To quantitatively evaluate the production of biofilm by MTP assay, from the samples enriched on trypticase soy broth (TSB) medium, turbidity equivalent to 0.5 McFarland was prepared and then 200 μL of each suspension was transferred to wells of 96-well polyester microplate and incubated for 20h at 37°C. Then, the wells washed (4 times) using phosphate buffered saline (PBS) and dried completely. Next, the wells were stained with crystal violet dye (1%) for 15 minutes and to remove the dye from the bacterial wall, 100 μL of a mixture of isopropyl alcohol 10% and ethanol 70% was added to each well. Finally, the light absorption of each well at 570 nm was investigated using an ELISA reader. Finally, the optical density (OD) of the wells were measured using an ELISA reader at a wavelength of 570 nm. The test was conducted in triplicate. Exegesis of results were performed as per the criteria explained (18) and the bacteria were divided into weak (non-producer), moderate and strong biofilm producers. S. aureus ATCC 25923 was used as positive control, for the biofilm assay.

DNA Extraction
DNA extraction was performed by the boiling technique using lysis buffer (1% Triton x100, 0.5% Tween 20, Tris 10 mmol with pH: 8 and EDTA 1 mmol) (19).

Molecular Confirmation of S. aureus Isolates
Amplifying the thermonuclease gene by polymerase chain reaction (PCR) was used for molecular confirmation of isolates (Table 1). For this test, distilled water and S. aureus ATCC 33591 were utilized as negative and positive controls, respectively. The final volume of each reaction was considered to be 20 μL and the PCR reaction temperature program is shown in table 2.  The products of PCR were evaluated using 1% agarose gel and UV transilluminator. Samples with 279 bp band were considered as S. aureus (20).

Molecular Identification of Biofilm-Producing Strains
Amplification of icaABCD operon genes (with icaA, icaD, icaC and icaB genes) was used to identify biofilm-producing strains by PCR (Table 1). Distilled water and S. aureus ATCC 25923 were used as negative and positive controls, respectively, for this test. The final volume of each reaction was considered to be 20 μL and the PCR reaction temperature program of this operon is shown in Table 2. The products of PCR were evaluated using 1% agarose gel and UV transilluminator. The size of products of the genes are shown in Table 1 (21).

Table 1. Primers used in the study

Reference Primer sequence Product size (bp) Gene
20 F: GCGATTGATGGTGATACGGTT
R: AGCCAAGCCTTGACGAACTAAAGC
279 nuc
21 F: ACACTTGCTGGCGCAGTCAA
R:TCTGGAACCAACATCCAACA
188 icaA
21 F: AGAATCGTGAAGTATAGAAAATT
R: TCTAATCTTTTTCATGGAATCCGT
880 icaB
21 F: ATGGGACGGATTCCATGAAAAAGA
R: TAATAAGCATTAATGTTCAATT
1066 icaC
21 F: ATGGTCAAGCCCAGACAGAG
R: AGTATTTTCAATGTTTAAAGCAA
198 icaD


Table 2. PCR reaction program (30 cycles)

  Steps, temperature and time of PCR reaction
Gene Primary denaturation Denaturation Annealing Extension Final extension
nuc 94°C, 5 min 94°C, 30 sec 55°C, 55 sec 72°C, 60 sec 72°C, 10 min
icaA 94°C, 5 min 94°C, 60 sec 55°C, 60 sec 72°C, 60 sec 72°C, 10 min
icaB 94°C, 5 min 94°C, 60 sec 52°C, 30 sec 72°C, 90 sec 72°C, 10 min
icaC 94°C, 5 min 94°C, 60 sec 55°C, 30 sec 72°C, 30 sec 72°C, 10 min
icaD 94°C, 5 min 94°C, 0 sec 55°C, 30 sec 72°C, 60 sec 72°C, 10 min

Statistical Analysis
Data are analyzed by SPSS 20 (SPSS Inc., Chicago, IL., USA). X2 (Chi-square) test was utilized for data analysis. P-value<0.05 was considered statistically significant.


 

Results

Out of 200 cultured clinical specimens, 83 (41.5%) cases were phenotypically identified as S. aureus; 23 isolates (27.71%) from urine, 17 isolates (20.48%) from catheter, 15 isolates (18.07%) from blood, 12 isolates (14.45%) from wound, 9 isolates (10.84%) from secretions, 5 isolates (6.02%) from nasal swabs and 2 isolates (2.40%) from sputum were isolated, that all phenotypically confirmed isolates had nuc gene by molecular tests  (Figure 1).


Figure 1. Electrophoresis of nuc gene PCR product lane M -marker 100 bp, lane 1- Positive control (S. aureus ATCC33591), lane 2- Negative control (distilled water), lanes 3 to 5- Study samples

Antimicrobial Resistance Patterns
The results of the antimicrobial resistance test are shown in Table 3.

Table 3. Antibiogram test results of Staphylococcus aureus isolates

Antibiotic Resistant/ n (%) Intermediate/ n (%) Sensitive/ n (%)
Penicillin (10 IU) 78 (94*) - 5 (6)
Ciprofloxacin (5 μg) 35 (43) 2 (2) 46 (55)
Tetracycline (30 μg) 60 (72) 10 (12) 13 (16)
Chloramphenicol (30 μg) 36 (43) 24 (29) 23 (28)
Cefoxitin (30 μg) 42 (51) - 41 (49)
Gentamicin (10 μg) 37 (45) 1 (1) 45 (54)
Erythromycin (15 μg) 36 (43) 3 (4) 44 (53)
Cephalothin (30 μg) 27 (33) 12 (14) 44 (53)
Ampicillin (15 μg) 45 (54) 9 (11) 29 (35)
Clindamycin (2 μg) 23 (28) - 60 (72)
Cotrimoxazole (25 μg) 32 (39) 4 (5) 47 (56)
Doxycycline (30 μg) 3 (4) 5 (6) 75 (90)

* Percentages are rounded

The highest resistance of isolates was to penicillin (94%), tetracycline (72%), ampicillin (54%) and cefoxitin (51%), respectively, and the highest susceptibility of isolates was reported to doxycycline (90%), clindamycin (72%), cotrimoxazole (56%) and ciprofloxacin (55%), respectively. Based on the results, 51% (42 cases) of isolates were considered as Methicillin-resistant S. aureus (MRSA) strains.

Biofilm Formation
According to the results of the Congo red test, out of 83 isolates, 23 (27.70%) isolates had a black colony (strong biofilm), 31 (37.30%) isolates had a dark red colony (weak biofilm) and 29 (35%) isolates with bright red colonies (lacking the ability to produce biofilm). The results of quantitative biofilm formation test (MTP) showed that 29 (35%) isolates had strong biofilm, 25 (30%) isolates had weak biofilm and 29 (35%) isolates lacked the ability to produce biofilm. Overall, 54 (65%) isolates were considered as positive biofilm strains.
Based on the results of table 4, a statistically significant difference was observed between qualitative results (Congo red) and quantitative results (MTP) of biofilm production by chi-square test (P<0.05, 0.001, X2 = 54.9, df = 4).
As shown in Table 5, there is a statistically significant difference between the microbial resistance of positive and negative biofilm of S. aureus strains to the antibiotics of ciprofloxacin, cefoxitin, gentamicin, erythromycin, cephalothin and cotrimoxazole (P <0.05).

Table 4. Comparison of quantitative (Congo red) and qualitative (MTP) test results of biofilm production

MTP test
 
Congo red test
Strong adherence weak adherence No adhesion Total
Black colony 17 6 0 23
Dark red colony 12 19 0 31
Bright red colonies 0 0 29 29
Total 29 25 29 83


Table 5. Comparison of antimicrobial resistance pattern in biofilm-negative and biofilm- positive isolates

Antibiotic BP1 (n= 54 )/ n (%) BN2 (n= 29 )/ n (%) P-value
Penicillin 54 (100*) 24 (83) 0.465
Ciprofloxacin 33 (61) 2 (7) 0.026
Tetracycline 42 (78) 18 (62) 0.185
Chloramphenicol 25 (46) 11 (38) 0.505
Cefoxitin 40 (74) 2 (7) 0.007
Gentamicin 37 (100) - 0.002
Erythromycin 36 (100) - 0.002
Cephalothin 27 (100) - 0.002
Ampicillin 31 (57) 14 (48) 0.427
Clindamycin 17 (31) 6 (21) 0.315
Cotrimoxazole 32 (100) - 0.002
Doxycycline 2 (3) 1 (3) -
  1. Biofilm producer
  2. Biofilm non-producer

Percentages are rounded

Table 6. Comparison of MDR and resistance to methicillin in biofilm-negative and biofilm- positive isolates

Isolate type MDR1, n (%) Non-MDR, n (%) MRSA, n (%) MSSA2, n (%)
Biofilm producer
(n= 54)
47 (87*) 7 (13) 24 (44) 30 (56)
Biofilm non-producer
(n= 29)
0 (-) 29 (100) 0 (-) 29 (100)
Total
(n= 83)
47 (57) 36 (43) 24 (29) 59 (71)

1- Multidrug-resistant
2- Methicillin-sensitive S. aureus
* Percentages are rounded


Of the total isolates, 47 (57%) were multidrug-resistant that included all biofilm-positive isolates,47 (57%), while 7 (13%) were non-MDR. All the biofilm negative isolates were non-MDR isolates (P<0.05; Table 6). Also, 24 (29%) of the isolates were MRSA. It is worth noting, 44% of biofilm positive isolates were MRSA, while all biofilm negative isolates were methicillin-sensitive S. aureus (MSSA) (P<0.05; Table 6). There was a statistically significant difference between the type of strain and biofilm production by X2 test (P<0.05 0.001, X2 = 108.1, df = 3).

Molecular Evaluation of icaABCD Operon
In the Molecular evaluation of icaABCD operon, the frequency of icaA, icaB, icaC and icaD genes were 67.4% (56 isolates), 60.2% (50 isolates), 61.4% (51 isolates) and 62.6% (52 isolates), respectively. Accordingly, the most common gene encoding biofilm production in the studied isolates are icaA and icaD genes. Out of 83 isolates, 50 isolates (60%) had both icaA and icaD genes and 34 isolates (41%) had all ica operon genes. There was not statistically significant difference between the presence of ica operon genes in S. aureus isolates.


Figure 2. Electrophoresis of ica operon genes PCR products lane M -marker 100 bp, lanes 1 and 2- positive samples for icaA gene (188 bp), lanes 3 to 5- positive samples with icaD gene (198 bp), lanes 6 and 7- positive samples for icaC gene (1066 bp), lanes 8 and 9- positive samples for icaB gene (880 bp), lane 10- Negative control (distilled water)


 

Discussion

According to the results of this study, the prevalence of S. aureus in clinical specimens was 41.5%. The results of various studies have shown similarities and differences in this field, including: Neopane et al. (2018) in Nepal reported that the prevalence of S. aureus in clinical specimens is 28.66% (11). In another study in India (2018), Manandhar et al reported a prevalence 43% of this bacterium in clinical specimens (23). In a similar study in Tehran that it conducted by Mashaiekhi and Amini (2018), the prevalence of S. aureus was calculated to be 17.09% (24). The difference in the prevalence of S. aureus in clinical specimens may be related to differences in specimen type, geographical location, sampling time, sampling location, etc.
Based on the results of antibiogram test in the present study, the highest resistance of isolates was to penicillin (94%), tetracycline (72%), ampicillin (54%), cefoxitin (51%) and gentamicin (37%), respectively. The results of Nourbakhsh and Momtaz,s study (2016) showed that the highest resistance of S. aureus isolates in clinical samples was related to penicillin (100%) and tetracycline (76%), which is consistent with the results of the present study (25). In the study of Sadri et al., resistance to tetracycline was reported to be 42% (26). In the study of Ahmadi et al., 20% resistance to gentamicin was reported in Kermanshah, also, the resistance to ampicillin was reported to be 55% (27). 23% resistance of S. aureus strains to gentamicin was also observed in the study of Hauschild et al. (28). A study by Mirzaee et al. in Tehran showed that more than 80% of S. aureus isolates are ampicillin-resistant (29). The present study shows the high prevalence of MRSA strains (51%) in different wards of AJA hospitals that comparing these results with the results of other studies in this field, showed many differences and similarities. Abdollahi et al. (2011) in Fars reported thet the rate of methicillin-resistance in S. aureus isolates was 47.56% (30). Also, several studies were conducted on the prevalence of MRSA islolates, which 43.5%, 50%, 12.6% and 30% of isolates in the study of Abu-Shady et al. (31), Hassanzadeh et al. (34), Tabaei et al. (32) and Rahimi et al. (33), were resistant to methicillin, respectively. The resistance of S. aureus isolates to methicillin can be due to overuse of antimicrobial compounds for disinfecting hospital environments, treatment of infections, transfer of patients colonized with these strains from one hospital to another, etc (22). As a result, it is necessary to monitor the use of drugs and disinfectant compounds, teach the correct methods of using antibiotics and infection control proceedings in all wards of hospitals.
Numerous studies on the pattern of antibiotic resistance of S.aureus isolates have been published from different wards of hospitals in different regions that are consistent or inconsistent with the results of our study. In the study of Ahmadi et al. (2014), the highest antibiotic resistance was reported to penicillin, tetracycline, methicillin and ampicillin (27). Also, in the study of Hatefizade et al. in Tehran (2016), the highest resistance to penicillin and ampicillin was observed (35), which these results were consistent with the results of the present study. In 2017, a study was conducted by Motamedi et al. in Hamedan. The results of this study showed that the highest antibiotic resistance is to erythromycin (36), which is in contrary to the results of the present study. These differences in the results can be due differences in a geographical area, the hygienic status of hospital wards (34) as well as creating chromosomal resistance during generation or transmission of resistance factors between bacterial species (36).
In the present study, in addition to emphasizing the spread of multiple drug resistance in clinical specimens, the ability to produce biofilm as a phenotype was reported to be 65%; This was consistent with the results of studies by Namvar et al. (2013) (13) and Croes et al. (2009) (37). In a similar study by Gad et al. (2009), the ability to produce biofilm was reported in 83% of isolates (38). In another study in Nepal conducted by Neopane et al. (2018), biofilm-producing strains were reported about 70% (10). Various factors can contribute to biofilm formation, including environmental factors (such as sugars, or proteases in the growth medium), nutrient availability, geographical origin, sample type, area surface (rough or smooth), porosity, Environmental stresses (such as antibiotic exposure), surface adhesion characteristics, and bacterial genetic arrangement. Furthermore, mutations in the ica operon genes and the regulatory genes of this operon are associated with a reduction in the ability of S. aureus to produce biofilms (10).
In the present study, the frequency of icaA, icaB, icaC and icaD genes were 67.4% (56 isolates), 60.2% (50 isolates), 61.4% (51 isolates) and 62.6% (52 isolates), respectively, which is consistent with the results of Nourbakhsh and Momtaz,s study in 2016 (25). In a study by Eftekhar et al. (2011), 73% of the isolates contained the icaA and icaB genes (22). Also, in the study of Namvar et al., all isolates have had icaC gene (13). In the present study, 60% of the isolates had both icaA and icaD genes and 41% of the isolates had all the ica operon genes, while strong biofilm was observed in only 35% of the isolates. In the study of Mirzaee et al. (2014) in Tehran, it was found that about 28% of the isolates had all the ica operon genes, while only half of these isolates were able to form a strong biofilm (29). In the Mashaiekhi and Amini,s study (2016), 75% of S. aureus isolates have had both icaA and icaD genes (24). In the study of the presence of genes and phenotypic biofilm formation, differences were observed that depending on the factors mentioned earlier. Therefore, the presence or absence of a gene alone can’t play a major role in biofilm formation. In the present study, there were two genes (icaA and icaD) in 60% of isolates and there were in 41% of isolates all of ica operon genes. The Isolates were placed between strong and weak spectra in biofilm formation, but none of these isolates were seen with the inability to form biofilms.


 

Conclusion

Pursuant to the results of this study, S. aureus isolates have had high resistance to most of the studied antibiotics (especially methicillin). Also, the significant abundance of biofilm-producing genes in these isolates can be effective in increasing the multiple drug resistance, persistence of bacteria in the environment (especially in hospital environments). In the present study, there was a statistically significant relationship between biofilm formation and antibiotic resistance (P<0.05). The presence of biofilm-producing genes and their role in antibiotic resistance can have consequences such as prolonged hospitalization, increased costs, and increased mortality (especially those admitted to the burn ward, immunosuppressed patients, and those undergoing aggressive treatments such as the use of artificial implants).
 
 

Acknowledgements

The authors thank the Research Assistance of AJA University of Medical Sciences and the staff of AJA hospitals in Tehran for their assistance in conducting this study.


 

Conflicts of Interest

Authors declared no conflict of interests.


 

Type of Study: Original Research Article | Subject: Medical Bacteriology
Received: 2020/05/14 | Accepted: 2020/08/31 | ePublished: 2020/10/5

References
1. Foster TJ, O'Reilly M, Patel AH, Bramley AJ. Genetic studies of Staphylococcus aureus virulence factors. Antonie Van Leeuwenhoek 1988; 54(5): 475-82. [DOI:10.1007/BF00461866] [PMID]
2. Oyama T, Miyazaki M, Yoshimura M, Takata T, Ohjimi H, Jimi S. Biofilm-Forming Methicillin-resistant Staphylococcus aureus Survive in Kupffer Cells and Exhibit High Virulence in Mice. Toxins. 2016 Jul;8(7):198. [DOI:10.3390/toxins8070198] [PMID] [PMCID]
3. Rahimi F, Katouli M, Karimi S. Biofilm production among methicillin resistant Staphylococcus aureus strains isolated from catheterized patients with urinary tract infection. Microbial pathogenesis. 2016;98:69-76. [DOI:10.1016/j.micpath.2016.06.031] [PMID]
4. Shahmohammadi MR, Nahaei MR, Akbarzadeh A, Milani M. Clinical test to detect mecA and antibiotic resistance in Staphylococcus aureus, based on novel biotechnological methods. Artificial cells, nanomedicine, and biotechnology. 2016;44(6):1464-8. [DOI:10.3109/21691401.2015.1041639] [PMID]
5. Becker K, Denis O, Roisin S, Mellmann A, Idelevich EA, Knaack D, et al. Detection of mecA- and mecC-Positive Methicillin-Resistant Staphylococcus aureus (MRSA) Isolates by the New Xpert MRSA Gen 3 PCR Assay. J Clin Microbiol. 2016; 54(1): 180-4. [DOI:10.1128/JCM.02081-15] [PMID] [PMCID]
6. Havaei SA, Assadbeigi B, Esfahani BN, Hoseini NS, Rezaei N, Havaei SR. Detection of mecA and enterotoxin genes in Staphylococcus aureus isolates associated with bovine mastitis and characterization of Staphylococcal cassette chromosome mec (SCCmec) in MRSA strains. Iran J Microbiol. 2015; 7(3): 161-7.
7. Federman C, Ma C, Biswas D. Major Components of Orange Oil Inhibit Staphylococcus aureus Growth and Biofilms Formation, and Alter Its Virulence Factors. Journal of Medical Microbiology. 2016; 65(7): 688-695. [DOI:10.1099/jmm.0.000286] [PMID]
8. Thilakavathy P, Priyan RM, Jagatheeswari PA, Charles J, Dhanalakshmi V, Lallitha S, et al. Evaluation of Ica Gene in Comparison with Phenotypic Methods for Detection of Biofilm Production by Coagulase Negative Staphylococci in a Tertiary Care Hospital. J Clin Diagn Res. 2015; 9(8): 16-9. [DOI:10.7860/JCDR/2015/11725.6371] [PMID] [PMCID]
9. Tyner H, Patel R. Propionibacterium acnes biofilm - A sanctuary for Staphylococcus aureus. Anaerobe. 2016; 40: 63-7. [DOI:10.1016/j.anaerobe.2016.05.014] [PMID]
10. Neopane P, Prasad Nepal H, Shrestha R, Uehara O, Abiko Y. In Vitro Biofilm Formation by Staphylococcus aureus Isolated From Wounds of Hospital-admitted Patients and Their Association With Antimicrobial Resistance. International Journal of General Medicine. 2018; 11: 25-32. [DOI:10.2147/IJGM.S153268] [PMID] [PMCID]
11. Costa MO, Beltrame CO, Ferreira FA, Botelho AM, Lima NC, Souza RC, et al. Complete Genome Sequence of a Variant of the Methicillin-Resistant Staphylococcus aureus ST239 Lineage, Strain BMB9393, Displaying Superior Ability to Accumulate ica-Independent Biofilm. Genome announcements. 2013;1(4). [DOI:10.1128/genomeA.00576-13] [PMID] [PMCID]
12. Naicker PR, Karayem K, Hoek KG, Harvey J, Wasserman E. Biofilm Formation in Invasive Staphylococcus aureus Isolates is Associated With the Clonal Lineage. Microb Pathog. 2016; 90: 41-9. [DOI:10.1016/j.micpath.2015.10.023] [PMID]
13. Namvar AE, Asghari B, Ezzatifar F, Azizi G, Lari AR. Detection of the Intercellular Adhesion Gene Cluster (ica) in Clinical Staphylococcus aureus Isolates. GMS Hyg Infect Control. 2013; 8(1): 03.
14. Murray P, Rosenthal K, Kobayashi G, et al. Medical microbiology. 6rd ed. Missouri: Mosby Inc.St.Louis, 2010.
15. Pa W. Clinical and Laboratory Standard Institute C. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically Approved Standard M7-A7 Clinical and Laboratory Standard Institute. 2006.
16. Doebbeling B. The Epidemiology of Methicillin-resistant Staphylococcus aureus Colonisation and Infection. J Chemother. 1995; 7(3): 99-103.
17. Silva G, Kantzanou M, Justice A, Massey RC, Wilkinson AR, Day N, Peacock SJ. The ica Operon and Biofilm Production in Coagulase- Negative Staphylococci Associated with Carriage and Disease in a Neonatal Intensive Care Unit. J Clin Microbiol. 2002; 40(2): 382-8. [DOI:10.1128/JCM.40.02.382-388.2002] [PMID] [PMCID]
18. Christensen GD, Simpon WA, Younger JJ, Baddour LM, Barrett FF, Meleton DM, et al. Adherence of Coagulase-Negative Staphylococci to Plastic Tissue Culture Plates: a Quantitative Model for the Adherence of Staphylococci to Medical Devices. J Clin Microbiol. 1985; 22(6): 996-1006. [DOI:10.1128/JCM.22.6.996-1006.1985] [PMID] [PMCID]
19. Udo R, Hans-Jörg L, Michaela M, Birgit L, Norbert L. Rapid Identification of Methicillin-Resistant Staphylococcus aureus and Simultaneous Species Confirmation Using Real-Time Fluorescence PCR. J. Clin. Microbiol. 2000 38(6): 2429-2433. [DOI:10.1128/.38.6.2429-2433.2000] [PMID] [PMCID]
20. Zhang K, Sparling J, Chow BL, Elsayed S, Hussain Z, Church DL, et al. New Quadriplex PCR Assay for Detection of Methicillin and Mupirocin Resistance and Simultaneous Discrimination of Staphylococcus aureus from Coagulase-negative Staphylococci. Journal of Clinical Microbiology. 2004; 42(11): 4947-55. [DOI:10.1128/JCM.42.11.4947-4955.2004] [PMID] [PMCID]
21. Piechota M, Kot B, Frankowska-Maciejewska A, Grużewska A, Woźniak-Kosek A. Biofilm formation by methicillin-resistant and methicillin-sensitive Staphylococcus aureus strains from hospitalized patients in Poland. BioMed Research International. 2018 Dec 27;2018. [DOI:10.1155/2018/4657396] [PMID] [PMCID]
22. Eftekhar F, Dadaei T. Biofilm Formation and Detection of icaAB Genes in Clinical Isolates of Methicillin Resistant Staphylococcus aureus. Iranian Journal of Basic Medical Sciences. 2011; 14(2):132-6.
23. Manandhar S, Singh A, Varma A, Pandey S, Shrivastava N. Evaluation of methods to detect in vitro biofilm formation by staphylococcal clinical Isolates. BMC Res Notes. 2018; 11: 714. [DOI:10.1186/s13104-018-3820-9] [PMID] [PMCID]
24. Mashaiekhi S, Amini K. Antibiotic resistance pattern and biofilm production in Staphylococcus aureus isolates and Staphylococcus epidermidis isolated from hospital infections Tehran in 2016. Journal of Birjand University of Medical Sciences. 2018; 25(2): 160-166. (Persian).
25. Nourbakhsh F, Momtaz H. Evaluation of Phenotypic and Genotypic Biofilm Formation in Staphylococcus aureus Isolates Isolated from Hospital Infections in Shahrekord, 2015. AMUJ. 2016; 19(109): 69-79.
26. Sadri H, Owlia P, Shahrbanooie R. Vancomycin resistance among clinical isolates of Staphylococcus aureus. Arch Iranian Med. 2005; 8(2): 100-103.
27. Ahmadi Z, Tajbakhsh E, Momtaz H. Detection of the antibiotic resistance pattern in Staphylococcus aureus isolated from clinical samples obtained from patients hospitalised in Imam Reza hospital, Kermanshah. Journal of Microbial World. 2014; 6(4): 299-311.
28. Hauschild T, Sacha P, Wieczorek P, Zalewska M, Kaczyñska K, Tryniszewska E. Aminoglycosides resistance in clinical isolates of Staphylococcus aureus from a University Hospital in Bialystok, Poland. Folia Histochem Cytobiologica. 2008; 46(2): 225-228. [DOI:10.2478/v10042-008-0034-3] [PMID]
29. Mirzaee M, Najar-Peerayeh S, Behmanesh M, Forouzandeh Moghadam M, Ghasemian AM. Biofilm Formation and Presence of ica Genes in Staphylococcus aureus Isolated from Intensive Care Unit. J Mazandaran Univ Med Sci. 2014; 24(115): 43-51.
30. Abdollahi A, Kouhpaye SA, Najafipour S, Mansouri Y, Abdollahi Kherabadi S, Jafari S. Frequency of drug resistance and staphylococcal chromosomal cassette mec (SCCmec). Genotype in Methicillin-Resistant Staphylococcus aureus strains. Scientific and Research Journal of Alborz Medical Sciences. 2012; 1(1): 47-52.
31. Abu-Shady HM, El-Essawy AK, Salama MS, El-Ayesh AM. Detection and molecular characterization of vancomycin resistant Staphylococcus aureus from clinical isolates. African Journal of Biotechnology. 2012; 11(99): 494-503.
32. Tabaei S, Noghondar MK, Mohammadzadeh M, Ataei L, Amel Jamehdar S. Pattern of antibiotic resistance in methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from clinical specimens: Imam Reza hospital in Mashhad. Medical Journal of Mashhad University of Medical Sciences. 2016; 59(2): 64-70.
33. Rahimi F, Bouzari M, Katouli M, Pourshafie MR. Antibiotic resistance pattern of methicillin resistant and methicillin sensitive staphylococcus aureus isolates in Tehran, Iran. Jundishapur J Microbiol. 2013; 6:144-149. [DOI:10.5812/jjm.4896]
34. Hassanzadeh S, Pourmand MR, Hadadi A, Nourijeylani K, Yousefi M, Mashhadi R. Frequency and antimicrobial resistance patterns of methicillin resistant staphylococcus aureus in Tehran. J Med Bacteriol. 2013; 2: 41-46.
35. Hatefizade B, Hosseini F, Moradi Bidhendi S. Study of some of antiseptic drugs on Staphylococcal strains biofilm isolated from patients with infectious skin during 2014-2015 in Tehran city. Razi Journal of Medical Sciences. 2016; 23(148): 128-135.
36. Motamedi H, Asghari B, Tahmasebi H, Arabestani MR. Adhesion Factors and Association with Antibiotic Resistance among Clinical Isolates of Staphylococcus aureus. Iran J Med Microbiol. 2017; 11 (3): 27-36
37. Croes S, Deurenberg RH, Boumans ML, Beisser PS, Neef C, Stobberingh EE. Staphylococcus aureus biofilm formation at the physiologic glucose concentration depends on the S. aureus lineage. BMC Microbiol. 2009; 9: 229. [DOI:10.1186/1471-2180-9-229] [PMID] [PMCID]
38. Gad GF, El-Feky MA, El-Rehewy MS, Hassan MA, Abolella H, El-Baky R. M. Detection of icaA, icaD genes and biofilm production by Staphylococcus aureus and Staphylococcus epidermidis isolated from urinary tract catheterized patients. J Infect Dev Ctries. 2009; 3(5): 342-51. [DOI:10.3855/jidc.241] [PMID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc