Iranian Journal of Medical Microbiology

.

Toxoplasma gondii is a mandatory intracellular parasite that causes toxoplasmosis. About 500 million to one billion people in the world are infected with the parasite, which is mainly caused by eating undercooked meat, fruits, vegetables, or being exposed to soil and water contaminated with the parasite's infected eggs. (1). Manifestations of the disease range from mild flu-like symptoms to lymphadenopathy and Chorioretinitis. Transmission of a primary (acute) infection from a pregnant mother to the fetus is largely asymptomatic and can lead to miscarriage or congenital abnormalities such as hydrocephalus, microcephaly, intracranial calcification, Chorioretinitis, blindness, epilepsy, mental retardation, or problems in motor abilities (2).  On the other hand, the activation of a chronic infection in the nervous system following a weakened or impaired immune system in people with AIDS, organ transplants, or in patients with lymphoproliferative diseases can lead to central nervous system damage or complications such as encephalitis for which lack of in time diagnosis and proper treatment can have deadly consequences (3). Early detection of acute and chronic toxoplasmosis, followed by appropriate drug treatment in at-risk individuals, can reduce the severity of symptoms and the occurrence of life-threatening injuries (4). Therefore, the aim of this study was to use recombinant gra7 protein to design immunochromatographic methods for rapid diagnosis of specific IgG against T. gondii in three minutes.

Toxoplasma Culture and DNA Extraction
This experimental study was performed in 2017 with 204 serum samples from different laboratories in Tehran using non-probable sampling method. Toxoplasma-induced RH angles were used in frozen form from the Quality Control Department of the Razi Vaccine and Serum Research Institute. To remove the preservative, the parasite was washed once with PBS solution and then cultured twice by successive intracranial passages in the mouse. For the reproduction and maintenance of the parasite, 0.5 mL of peritoneal fluid containing 2×10⁵ live parasites was injected into each mouse and 100 ‌µL / mL of penicillin was injected intraperitoneally. After 3 to 4 days, the peritoneal cavity of infected mouse was washed with 5 mL of cold PBS buffer, and the tacos were collected and stored at -20˚C. To extract the genomic DNA, the toxoid plasma toxins were extracted from the DNA extraction kit by Synagen (Iran) in the DNG method according to the manufacturer's instructions.

Primer Design for GRA7 Gene and PCR
The gra7 gene sequence was extracted from the NCBI gene bank and designed with the enzyme sites of BglII and XhoI. The sequence of primers was confirmed using Gene Runner software.
GRA7 Forward: CAGCCCAGATCTGATGGCACGACACGCAAT
GRA7 Reverse: GTGGTGCTCGAGTTACTGGCGGGCATCCTC
The gra7 gene was amplified using PCR. The gra7 gene proliferation timing program using PCR includes initial denaturation for 5 minutes and 96°C, secondary denaturation for 30 seconds and 95°C temperature, Annealing for 30 seconds and 58°C temperature, Extension for 1 minute and temperature 7 C72 and final extension for 10 minutes at 72°C. In this process, 0.4 µM of each primer, 200 µm of any dNTP type, 1.5 unit / mL of Taq polymerase enzyme, 5 µL PCR buffer containing MgSO4 and 200 ng of the sample DNA with a final volume of 50 μL were used.

Preparation of Recombinant Plasmid and Cloning
The plasmid pET-32a (+) vector was first cut using BglII and XhoI and added to the purified PCR product. By adding the enzyme T4 ligase, the gene was added to the Recombinant Plasmid.
The recombinant plasmid was transferred to the Competent Cell Escherichia coli DH5α by heat shock. The bacterium was cultured in an LB culture medium containing 100 µg / mL of antibiotic. The recombinant plasmid was extracted using double enzyme digestion on gra7 -pET-32a (+) and PCR for the gra7 gene to confirm the accuracy of bacterial transformation.

Expression, Confirmation and Purification of GRA7 Protein
 The multiplied recombinant plasmid was transferred to E. coli Rosetta (DE3). A colony was removed from the newly transformed plate and cultured in a tube containing liquid LB and ampicillin, and the next day in a 25 mL Erlenmeyer flask. Four, six, and eight hours after induction, the environment was sampled. The collected samples were centrifuged at 6000 rpm and the final precipitate was stored in a freezer at -20°C. The Western blot method was used to confirm the gene expression. In order to purify gra7 by Ni-NTA method, first the cell sediment was melted at room temperature and the cells were lysed and then the cellular lyses were evaluated directly by SDS-PAGE. Also, the lyses-resin mixture was carefully passed through the Ni-NTA chromatography column and its output was collected.

Blotting Test
At this stage, the antigen gra7 was cut on the nitrocellulose paper and after the blocking phase with bovine serum albumin, the serum of patients with toxoplasmosis was evaluated with 1:30 dilutions. In this study, 204 serums from different laboratories that were examined and collected by CLIA method were used. There were 30 serums for people with clinical symptoms, 70 serums with IgM antibodies to Toxoplasma, 74 serums with IgG antibodies against Toxoplasma and 30 negative serums (no IgG antibodies against Toxoplasma). Also, 30 serum samples of people with IgG antibodies against other diseases, all of which were negative for IgM antibodies and IgG antibodies to toxoplasma, were evaluated for Bovine Serum Albumin (BSA). Ventricular leishmaniasis (n = 5), Strongyloidiasis (n = 1), malaria (n = 13), fascioliasis (n = 4), hepatitis (n = 3), hydatid cyst (n = 4) were used.

Immunochromatography Strip
After preparing the colloidal gold and conjugating the Anti-human IgG according to the relevant protocol (18), the tape was designed and tested. The conjugated solution was poured on the conjugation pad. A recombinant gra7 antigen suspension was added to the test line area. The control line was sampled with antibodies against the mouse antibody. All sheets were cut to a width of 4 mm.
The accelerated method was used to evaluate the kit stability time. The shelf life of the kit was calculated for 24 months.