year 14, Issue 5 (September - October 2020)                   Iran J Med Microbiol 2020, 14(5): 425-440 | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Bazrgari N, Garoosi G A, Dadar M. Genetic Diversity and Phylogenetic Relationship of Clinical Isolates of Brucella melitensis Based on Gene Polymorphism of β Subunit of RNA Polymerase (rpoB) Gene in Iran. Iran J Med Microbiol 2020; 14 (5) :425-440
URL: http://ijmm.ir/article-1-1182-en.html
1- Agricultural Biotechnology Department, Faculty of Engineering & Technology, Imam Khomeini International University, Qazvin, Iran
2- Brucellosis Department, Razi vaccine and serum Research Institute (RVSRI), Agricultural Research, Education and Extension Organization (AREEO), Karaj, Iran. , dadar.m77@gmail.com
Full-Text [PDF 1042 kb]   (2349 Downloads)     |   Abstract (HTML)  (7452 Views)
Full-Text:   (8899 Views)
Introduction

Brucellosis is the most common zoonotic disease that infects animals and humans through contaminated animals and their products. The disease is caused by an intracellular small gram- coccobacillus of the genus Brucella, which has no capsules, flagella and spores  cause destructive disease that leads to great economic losses to the livestock industry by reducing milk production Humans are usually infected through consumption of contaminated dairy products or close contact with infected animals (1). Human infection can lead to a chronic debilitating disease whose nonspecific symptoms affect various organs (2, 3). The genus Brucella has six classic species, including: . Brucella abortus, Brucella melitensis, Brucella ovis, Brucella suis, Brucella neotomae, Brucella canis. B. melitensis, B. abortus, B. canis, and B. suis can cause brucellosis in human (4). In addition, six non-classical species are known as Brucella species. Reports published in the last decade in Iran have introduced B. melitensis as the main pathogen responsible of brucellosis in human. Although. B. abortus was also involved to much lesser extent (6, 5). Rapid and accurate identification of Brucella species can indicate geographical and host origin. Currently, differentiation between species and biovars of Brucella are done using various analyze according to phage typing, phenotypic characteristics of lipopolysaccharide antigen, color sensitivity, need for carbon dioxide, the production of sulfide-hydrogen gas and metabolic properties (7). Diagnosis and detection of brucellosis based on biochemical tests is inefficient to differentiate Brucella species due to the presence of unknown behavioral strains in these experiments (8). Also, these experiments are potentially dangerous, complex and time consuming for laboratory technicians. Furthermore, Brucella identification complication can occurr due to similar differences between some species and inconstancy in reporting several phenotypic traits (9, 10). The use of genetic characteristics has been investigated using molecular DNA technology to address these shortcomings. Many PCR-based methods have been developed for rapid identification of Brucella species. For this purposes, molecular tests of the genome using the BCSP31 gene or 16SrRNA-23S operon are sufficient (11, 12), but for the other aims such as epidemiological tracking, more accurate methods are required. Due to the high DNA homology (above 90%) among Brucella species (14, 13), the significant genetic differences are mononucleotide polymorphisms, and regions with high genomic diversity between species are very rare (15). Several PCR-based methods have been used to determine the exact molecular biomarkers to determine Brucella molecular type (12). Various studies have reported that the use of the RNA polymerase (rpoB) β subunit gene, which is very suitable for phylogenetic analysis and identification Brucella strains, especially in highly homologous isolates (8, 15, 16 RpoB-based genotyping also allows the identification of new bacterial species and analysis  of the bacterial community (16). It can also describe rpoB gene mutations that play a very important role in rifampicin resistance (17). the present study evaluates the effectsof single nucleotide polymorphism (SNP) assays on the rpoB gene to show intra-species diversity occurring in different B. melitensis strains collected from various regions of Iran. (this part of manuscript is too long).

 

Materials and Methods

Sampling and bacteria isolation
In this study, a collection of 106 blood and 2 cerebrospinal fluid samples from patients with brucellosis symptoms from2017-2019 were cultured by the Brucellosis Department of Razi Vaccine and Serum Research Institute (Karaj, Iran). All samples were cultured in selective Brucella agar medium with Cycloheximide (50.0mg), Vancomycin (10.0mg), polymyxin B (2,500 IU), Bacitracin (12,500 IU), Nystatin (50,000 IU), and Nalidixic acid (2.5mg) (Oxoid, Basingstoke, UK) and 5% of inactivated horse serum. Bacterial cultures were incubated for 10 days at 37 ° C and 10% carbon dioxide. After this steps , the isolated bacteria were identified by classical typing methods (5, 18). Brucella isolated from patients and standard bacterium of B.melitensis 16M (ATCC 23456) were then used in this study to analyze rpoB gene by single nucleotide polymorphism.  Genomic DNA extraction was performed based on the manufacturing protocol by a high purity PCR template preparation kit (Roche, Germany) on isolated bacteria. The integrity of DNA was evaluated by 1% agarose gel and the concentration of DNA was assessed at 260/280 nm by a Nanodrop Spectrophotometer (Wilmington, DE, USA). The DNA of bacterial samples were then preserved at − 20 °C for analysis.

Molecular confirmation of isolated bacteria
Molecular identification of isolated bacteria in Brucella agar-specific medium was performed based on the IS711-based polymerase chain reaction (AMOS-PCR) and Bruce-ladder PCR were carried out on all extracted DNA to analyze the Brucella presence in samples. Amos-PCR amplification using 5 primers on the IS711 gene (Table 1) was done in a thermal program of 1 cycle of 95 ° C for 5 minutes, followed by 40 cycles of denaturation at 95 ° C for 30 seconds, annealing temperature at 55 ° C for 60 seconds, extension at 72 ° C for 3 minutes and final extension at 72 ° C for 10 minutes (19). Molecular typing also was performed by multiplex PCR (Bruce-ladder) with 16 primers on 8 different Brucella genes (Table 1) as follows: 95 ° C for 5 minutes, followed by 30 cycles at 95 ° C for 30 minutes,56 ° C for 90 seconds, 72 ° C for 3 minutes and at 72 ° C for 10 minutes (4). All reactions of PCR were conducted in a total volume of 25 μL including 0.2 mM deoxynucleotide triphosphate, 0.5 mM of each primer, 10 mM Tris–HCl (pH 8), 50 mM KCl, 1.5 mM MgCl2, and 0.05 IU of Taq polymerase. The PCR products were run by electrophoresis on the 1.5 % agarose gel. All applied primers in this study are mentioned in the table 1.

PCR assay on the rpoB gene and its genotyping assignment
The PCR amplifications of the rpoB gene was done with specific primers using the B. melitensis 16M (accession number AE009516) as reference. Upstream primer, 1rB (5-ATGGCTCAGACCCATTCTTTC-3), and a downstream primer, 4134rB (5-TTATTCTGCCGCGTCCGGAA-3) were used to amplify the whole length of rpoB gene with 4,134-bp (17). PCR amplifications were performed with 25 μL of PCR mixture comprised of 10 mM Tris–HCl (pH 8), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM deoxynucleotide triphosphate, 0.05 IU of Taq polymerase, 0.5 mM of each primer and 100 ng of genomic DNA (evaluated by O.D. at 260 nm). To determine the rpoB types of different B. melitensis phenotypic biovars, the rpoB molecular targeting of specific residues on the codons 629, 985, 1249, and 1309 were performed using Mega 6 software (20).

Sequence analysis
The purification of PCR products were performed by PCR product purification kit (GeneAlI Company, South Korea) and sent to Fazapjooh Company for sequencing. The rpoB sequences were then aligned and assembled by the Mega 6 software program (21). In addition, the amino acids were deduced by the CLUSTAL W method of the Mega 6 program. After that all generated sequences with specific primers and length of 4134 bp, were compared by rpoB gene of B. melitensis 16M (accession number AE009516) for evaluation of nucleotide diversity. Sequencing was performed twice to confirm the results of reported mutations in this study.

Phylogenetic analysis
The consensuses data of all sequences were evaluated using the NCBI (Blast) alignment search tool to confirm rpoB genes matching. A phylogenetic tree was then drawn with Bootstrap 1000 (22). Bootstrap values from 1000 Bootstrap datasets were displayed at the end of the nodes.

Table 1. Primers used to identify isolated bacteria and PCR product sizes expected for different types of Brucella

Bacterial strains Primer set Primer sequence (5-3’) DNA target size (bp) References
B. abortus IS711
AB
TGCCGATCACTTTCAAGGGCCTTCAT
GACGAACGGAATTTTTCCAATCCC
IS711 498 (19)
B. melitensis IS711
BM
TGCCGATCACTTTCAAGGGCCTTCAT AAATCGCGTCCTTGCTGGTCTGA IS711 731 (19)
B.ovis IS711
B.ovis
TGCCGATCACTTTCAAGGGCCTTCAT
CGGGTTCTGGCACCATCGTCG
IS711 976 (19)
B.suis IS711
B.suis
TGCCGATCACTTTCAAGGGCCTTCAT
GCGCGGTTTTCTGAAGGTTCAGG
IS711 285 (19)
B. abortus
B. melitensis
B. melitensis Rev.1
BMEI0998f
BMEI0997r
ATC CTA TTG CCC CGATAA GG
 
GCT TCG CAT TTT CACTGT AGC
Glycosyltransferase, gene
wboA
1,682 (4)
B. abortus
B. melitensis
B. melitensis Rev.1
BMEI0535f
BMEI0536r
GCG CAT TCT TCG GTTATG AA
CGC AGG CGA AAA CAGCTA TAA
Immunodominant
antigen, gene bp26
450 (4)
Deletion of 25,061 bp in
BMEII826–BMEII0850 in
B. abortus
BMEII0843f
BMEII0844r
TTT ACA CAG GCA ATCCAG CA
GCG TCC AGT TGT TGTTGA TG
Outer membrane protein, gene omp31 1071
 
(4)
B. abortus
B. melitensis
B. melitensis Rev.1
BMEI1436f
 
BMEI1435r
ACG CAG ACG ACC TTCGGTAT
TTT ATC CAT CGC CCTGTCAC
Polysaccharide
deacetylase
794 (4)
B. abortus
B. melitensis
B. melitensis Rev.1
BMEII0428f
 
BMEII0428r
GCC GCT ATT ATG TGGACT GG
AAT GAC TTC ACG GTCGTT CG
Erythritol catabolism,
gene eryC (Derythrulose-
1-phosphate
dehydrogenase)
587 (4)
Deletion of 2,653 bp in BR0951–
BR0955 in B. melitensis and
B. abortus
BR0953f
BR0953r
GGA ACA CTA CGC CACCTT GT
GAT GGA GCA AAC GCTGAA G
ABC transporter binding protein 272 (4)
Point mutation in BMEI0752 in B. melitensis Rev.1
 
BMEI0752f
BMEI0752r
 
CAG GCA AAC CCT CAG AAG C
GAT GTG GTA ACG CAC ACC AA
 
Ribosomal protein S12, gene rpsL 218 (4)
B. abortus
B. melitensis
B. melitensis Rev.1
BMEII0987f
BMEII0987r
 
CGC AGA CAG TGA CCATCA AA
GTA TTC AGC CCC CGTTAC CT
Transcriptional
regulator, CRP family
152 (4)


 

Results

Isolation and identification of bacteria
In this study, Brucella isolates (n=11) were detected from 108 blood samples from cases of brucellosis, 10 bacterial isolates from blood and 1 bacterial isolate from cerebrospinal fluid. Common phenotypic characteristics of Brucella species were observed from isolated bacteria including small glossy t shiny, and honey colonies with smooth surface. Eleven bacterial isolates were grown after 5 days of incubation at 37°C with 10% carbon dioxide. Isolated bacteria were gram-negative in gram staining, did not produce hydrogen sulfide and did not lyse with standard phages in the classic Brucella detection method, and also grew on Fuchsin and tionine dyes, so according to OIE standard tables for the identification Brucellae at the biovar level, it was identified as belonging to B. melitensis bivar 1 and 3 (Table 2).

Table 2. B. melitensis isolates and identification using different molecular typing methods.

Isolate Accession number Source Biotype Bruce-ladder Amos PCR year Place
S1 MK629658 Human blood B. melitensis bv3 B. melitensis B. melitensis 2018 Karaj
S2 MK629659 Human blood B. melitensis bv3 B. melitensis B. melitensis 2016 Karaj
S3 MK629660 Human blood B. melitensis bv1 B. melitensis B. melitensis 2016 Karaj
S4 MK629661 Human blood B. melitensis bv1 B. melitensis B. melitensis 2015 Qom
S5 MK790247 Human blood B. melitensis bv1 B. melitensis B. melitensis 2019 Kerman
S6 MK790248 Human synovial fluid B. melitensis bv1 B. melitensis B. melitensis 2016 Tehran
S7 MK598748 Human blood B. melitensis bv1 B. melitensis B. melitensis 2017 Karaj
S8 MK790249 Human blood B. melitensis bv1 B. melitensis B. melitensis 2018 Mashhad
S9 MK790250 Human blood B. melitensis bv1 B. melitensis B. melitensis 2015 Hamadan
S10 MK790251 Human blood B. melitensis bv1 B. melitensis B. melitensis 2019 Kermanshah
S11 MK790252 Human blood B. melitensis bv1 B. melitensis B. melitensis 1017 Yazd

Molecular confirmation of isolated bacteria
Isolated bacteria were identified and confirmed at the molecular level using AMOC PCR and Bruce-ladder multiplex methods at the species level. In terms of biotype results, it was found that the clinical isolates belonged to B. melitensis bivar 1 or 3. For the AMOS-PCR assay, a product of 731 bp for all isolates, indicating the genus B. melitensis, was identified. All isolates in Bruce-ladder PCR reaction was also confirmed the amplification of PCR products with 152, 450, 587, 794, 1,071 and 1682 bp as filed type of B. melitensis.

Determination of Brucella genotype based on rpoB gene analysis
The differentiating power of rpoB gene for Brucella detection was first confirmed for Iranian Brucella isolates using single nucleotide polymorphism analysis of rpoB gene, moreover, the results were compared with the sequences recorded in the NCBI database. According to our results, most Iranian isolates in this study were classified as the rpoB with 629-Val (GTG), 985-Val (GTC), 1249-Met (ATG) and 1309-Leu (CTA) genomic maps While only one of them belonged to rpoB type 1 with genomic map (629-Ala (GCG), 985-Ala (GCC), 1249-Met (ATG) and 1309-Leu (CTG). The gene and amino acid sequences were stored in the NCBI database under access numbers MK629658, MK629659, MK629660, MK629661, MK790247, MK790248, MK598748, MK790249, MK790250, MK790251 and MK790252. Also, the ability of rpoB gene differentiation to identify Brucella Iranian isolates was confirmed for the first time in this study. Most of the Iranian isolates in this study belonged to rpoB type 2 and only one of them belonged to rpoB type 1. Also, no spatial grouping of rpoB type 3 was identified in this study. Of the 10 rpoB type 2 strains, six strains with only one single nucleotide polymorphism at codon985, showed different variants, indicating the missense 985 -Ala (GCC) mutation instead of Val (GTC).
Therefore, these strains should be considered as a new variants of genotype 2 (Accession number: MK629658, MK629660, MK629661, MK790247, MK790249 and MK790252) (Fig 1).  In the other four isolates, no mutation pattern was observed in codon 985 of type 2 genotype.


Figure 1. Phylogenetic relationship using the Neighbor-Joining method shows the power of gene differentiation between Brucella species and other bacteria in the figure. The percentages of replications in which related species are grouped in the Bootstrap test (1000 replicates) are shown next to the branches. The Maximum Composite Likelihood method showed evolutionary distances. Evolutionary analysis was performed on MEGA6.


 

Discussion

Identification of Brucella species is one of the most important programs in brucellosis eradication and control issues as well as epidemiological trace analysis in human and animal. the worldwide distribution of Brucella infections in animals and humans highlights the vital need of different regional/local reference laboratories to use the same typing methods of Brucella bacteria in order to facilitate comparison and data exchange. At present, the identification Brucella species and subspecies according to the different characterization’s analysis consisting of biochemical phenotype, growth needs and serology. These tests are time consuming and increase the risk of infection for laboratory staff. In addition, the limited diversity of some Brucella species and biovares in biochemical properties may lead to conflicting data and complex interpretations (23). In some studies, it has been showed that clinical strains of B. melitensis isolated from human specimens show unusual phenotypic patterns in fuchsin and tionine dye sensitivity tests (15, 16). More recently, the B. melitensis biovar types 1, 2, and 3 have been isolated from numerous studies in African, Asian, South American, and European countries that differ in color sensitivity (24). Moreover, the biotypical characteristics of Brucella spp. isolates in Israel were serologically known as B. melitensis biovar 1, but showed unusual sensitivity to penicillin, and the dyes of fuchsin and tionine (9). Recent observations, however, indicate that differences between the species of B. melitensis are not limited to the agglutination pattern. Color sensitivity, while indicating a phenotypic feature, is also a factor for the B. abortus biovars identification (25). Hence, various molecular methods have been designed to identify Brucella species, for example, it has been shown that PCR-RFLP method is a fast and practical technique, particularly for differentiation and identification between different Brucella species and biovars of B. abortus and B. melitensis in human blood samples (26). In a further study, pulse-field gel electrophoresis (PFGE) was found to be a more reliable and useful method for the molecular typing of Brucella strains and the determination of genetic similarity between Brucella isolates in humans and animals than PCR RFLP (27). Also, optimized molecular hybrid methods are able to simultaneously identify and differentiate B. abortus and B. melitensis species with high specificity and sensitivity in clinical specimens (28). Furthermore, detection and differentiate of B. melitensis and B. abortus species by real-time PCR and high resolution melting analysis (HRM) curves in human blood has been expressed as a useful method compared to PCR-RFLP (29). In this study, comparison of B. melitensis rpoB sequences led to molecular and phylogenetic classification of 11 clinical isolates from different provinces of Iran (Figure 1). RpoB-based molecular typing enables us to determine and differentiate Brucella intraspecific genotypes and to analyze Brucella species from each other simultaneously based on a single nucleotide polymorphic analysis on the rpoB gene, which is not possible simultaneously in other molecular differentiation methods. Various studies have reported that the analysis of phylogenetic relation-ships based on rpoB gene was approximately three times more accurate than that obtained with 16S rRNA analyses in identifying highly homologous species of Brucella (8, 15, 30). Also, the 16S rRNA locus lacks sufficient sequence diversity to differentiate Brucella species (30).
 Furthermore, New identification methods have recently been reported by targeting the rpoB gene fragment located between positions 625, 985,1249, and 1390 to identify Brucella species.
Using this approach makes it possible to identify and differentiation closely identical bacteria with high homology in the genome. This method also revealed high sensitivity in differentiating Brucella spp. genotypes by rpoB gene sequencing (8, 31). Different genotypes of B. melitensis have been identified based on rpoB types due to the combination of mononucleotide polymorphisms (SNPs) in codons 629, 985, 1249 and 1309 (16). Up to now, 3 important genotypes according to the B. melitensis rpoB type have been demonstrated  in different counties, including the rpoB type 1, 629-Ala (GCG), 985-Ala (GCC), 1249-Met (ATG) and 1309-Leu (CTG); the rpoB type 2, 629-Val (GTG), 985-Val (GTC), 1249-Met (ATG) and 1309-Leu (CTA); and the rpoB type 3, 629-Ala (GCG), 985-Ala (GCC),1249-Ile (ATA) and 1309-Leu (CTG) (16, 20). The finding of the current study are consistent with the findings of a Spanish study that showed similar missense mutations at the same location (codon 985) for three of B. melitensis rpoB type 2. Other missense mutations have been reported in Turkey in genotype 2 of B. mensensis, including only two of the three missense mutations that were identified by Marianli et al. (16). According to Tan et al., most of the strains collected from American and European countries belong to type 1 rpoB, while type 2 rpoB is mainly reported among strains collected from Asia, Africa and Europe (8). However, our results showed that both type 1 and type 2 of rpoB were present in the Iranian isolates of B. melitensis. Phylogenetic analyzes performed in other studies also confirmed the use of neighbor-joining method in this study (15, 32). Finally, it can be confirmed that despite the high DNA homology in the genus Brucella, the rpoB gene can act as a highly specific and stable molecular marker in this gene (15, 32). This method also allows for rapid differentiation and identification of Brucella.


 

Conclusion

In the present study, the genotyping results of B. melitensis isolates using single nucleotide polymorphism analysis on the rpoB gene led to the successful identification and classification of Iranian clinical isolates and provided a better understanding of the distribution and transmission of Brucella spp. infecting human at a regional level. It was also found that biovar level detection could be performed without the need for special laboratory facilities.
 
 

Acknowledgements

We are very grateful to the Brucellosis Department of the Razi Vaccine and Serum Research Institute in Karaj for helping us with this research.us diseases experts for their valuable comments.


 

Conflicts of Interest

Authors declared no conflict of interests.


 

Financial support

This study was supported by the grant 2-18-18-036-960504 from the Razi Vaccine and Serum Research Institute; Agricultural Research, Education and Extension Organization (AREEO), Karaj, Iran


 

Type of Study: Original Research Article | Subject: Zoonoses Research
Received: 2020/07/10 | Accepted: 2020/09/14 | ePublished: 2020/10/5

References
1. Dadar M, Shahali Y, Whatmore AM. Human brucellosis caused by raw dairy products: A review on the occurrence, major risk factors and prevention. Int J Food Microbiol. 2018. [DOI:10.1016/j.ijfoodmicro.2018.12.009] [PMID]
2. Corbel MJ. Brucellosis: an overview. Emerg Infect Dis. 1997;3(2):213. [DOI:10.3201/eid0302.970219] [PMID] [PMCID]
3. Mirnejad R, Jazi FM, Mostafaei S, Sedighi M. Epidemiology of brucellosis in Iran: A comprehensive systematic review and meta-analysis study. Microb Pathog. 2017;109:239-47. [DOI:10.1016/j.micpath.2017.06.005] [PMID]
4. Lopez-Goñi I, Garcia-Yoldi D, Marin C, De Miguel M, Munoz P, Blasco J, et al. Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. J Clin Microbiol. 2008;46(10):3484-7. [DOI:10.1128/JCM.00837-08] [PMID] [PMCID]
5. Dadar M, Alamian S, Behrozikhah AM, Yazdani F, Kalantari A, Etemadi A, editors. Molecular identification of Brucella species and biovars associated with animal and human infection in Iran. Veterinary Research Forum; 2019: Faculty of Veterinary Medicine, Urmia University.
6. Asadi FT, Hashemi SH, Alikhani MY, Moghimbeigi A, Naseri Z. Clinical and diagnostic aspects of brucellosis and antimicrobial susceptibility of Brucella isolates in Hamedan, Iran. Jpn J Infect Dis. 2016:JJID. 2016.133.
7. Morgan W, Corbel M. Recommendations for the description of species and biotypes of the genus Brucella. Dev Biol Stand. 1976;31:27-37.
8. Tan K-K, Tan Y-C, Chang L-Y, Lee KW, Nor'e SS, Yee W-Y, et al. Geographical distribution of Brucella melitensis inferred from rpoB gene variation. The Journal of Infection in Developing Countries. 2017;11(05):420-5. [DOI:10.3855/jidc.7598] [PMID]
9. Banai M, Mayer I, Cohen A. Isolation, identification, and characterization in Israel of Brucella melitensis biovar 1 atypical strains susceptible to dyes and penicillin, indicating the evolution of a new variant. J Clin Microbiol. 1990;28(5):1057-9. [DOI:10.1128/JCM.28.5.1057-1059.1990] [PMID] [PMCID]
10. Meyer M. Evolution and taxonomy in the genus Brucella: contemporary evolutionary status of the species Brucella abortus. Am J Vet Res. 1976;37(2):203-5.
11. Baily G, Krahn J, Drasar B, Stoker N. Detection of Brucella melitensis and Brucella abortus by DNA amplification. Trop Med Int Health. 1992;95(4):271-5.
12. Costa MD, Guillou JP, Garin‐Bastuji B, Thiebaud M, Dubray G. Specificity of six gene sequences for the detection of the genus Brucella by DNA amplification. J Appl Bacteriol. 1996;81(3):267-75. [DOI:10.1111/j.1365-2672.1996.tb04328.x] [PMID]
13. VERGER J-M, GRIMONT F, GRIMONT PA, GRAYON M. Brucella, a monospecific genus as shown by deoxyribonucleic acid hybridization. International Journal of Systematic and Evolutionary Microbiology. 1985;35(3):292-5. [DOI:10.1099/00207713-35-3-292]
14. Verger J, Grimont F, GRIMONT PD, Grayon M, editors. Taxonomy of the genus Brucella. Annales de l'Institut Pasteur Microbiologie; 1987. [DOI:10.1016/0769-2609(87)90199-2]
15. Marianelli C, Ciuchini F, Tarantino M, Pasquali P, Adone R. Molecular characterization of the rpoB gene in Brucella species: new potential molecular markers for genotyping. Microbes and infection. 2006;8(3):860-5. [DOI:10.1016/j.micinf.2005.10.008] [PMID]
16. Sayan M, Yumuk Z, Bilenoglu O, Erdenlig S, Willke A. Genotyping of Brucella melitensis by rpoB gene analysis and re-evaluation of conventional serotyping method. Jpn J Infect Dis. 2009;62(2):160-3.
17. Marianelli C, Ciuchini F, Tarantino M, Pasquali P, Adone R. Genetic bases of the rifampin resistance phenotype in Brucella spp. J Clin Microbiol. 2004;42(12):5439-43. [DOI:10.1128/JCM.42.12.5439-5443.2004] [PMID] [PMCID]
18. Dadar M, Alamian S. Identification of main Brucella species implicated in ovine and caprine abortion cases by molecular and classical methods. Archives of Razi Institute. 2020.
19. Ewalt DR, Bricker BJ. Validation of the Abbreviated BrucellaAMOS PCR as a Rapid Screening Method for Differentiation ofBrucella abortus Field Strain Isolates and the Vaccine Strains, 19 and RB51. Journal of clinical microbiology. 2000;38(8):3085-6. [DOI:10.1128/JCM.38.8.3085-3086.2000] [PMID] [PMCID]
20. Valdezate S, Navarro A, Villalón P, Carrasco G, Saéz-Nieto JA. Epidemiological and phylogenetic analysis of Spanish human Brucella melitensis strains by multiple-locus variable-number tandem-repeat typing, hypervariable octameric oligonucleotide fingerprinting, and rpoB typing. J Clin Microbiol. 2010;48(8):2734-40. [DOI:10.1128/JCM.00533-10] [PMID] [PMCID]
21. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30(12):2725-9. [DOI:10.1093/molbev/mst197] [PMID] [PMCID]
22. Jukes TH, Cantor CR. Evolution of protein molecules. Mammalian protein metabolism. 1969;3:21-132. [DOI:10.1016/B978-1-4832-3211-9.50009-7]
23. Alton GG, Jones LM, Angus R, Verger J. Techniques for the brucellosis laboratory: Institut National de la recherche Agronomique (INRA); 1988.
24. Corbel M. Identification of dye-sensitive strains of Brucella melitensis. J Clin Microbiol. 1991;29(5):1066-8. [DOI:10.1128/JCM.29.5.1066-1068.1991] [PMID] [PMCID]
25. Stableforth A, Jones LM. Report of the Subcommittee on the Taxonomy of the Genus Brucella. Speciation in the Genus Brucella. International Bulletin of Bacteriological Nomenclature and Taxonomy. 1963;13(3):145-58. [DOI:10.1099/0096266X-13-3-145]
26. Mirnejad R, Mohammadi M, Majdi A, Taghizoghi N, Piranfar V. Molecular typing of Brucella melitensis and B. abortus from human blood samples using PCR-RFLP method. Jundishapur Journal of Microbiology. 2013;6(6):1B. [DOI:10.5812/jjm.7197]
27. Bahmani N, Mirnejad R, Arabestani MR, Mohajerie P, Hashemi SH, Karami M, et al. Comparison of PCR-RFLP and PFGE for determining the clonality of Brucella isolates from human and livestock specimens. Saudi J Biol Sci. 2019;26(2):256-62. [DOI:10.1016/j.sjbs.2017.08.017] [PMID] [PMCID]
28. Mirnejad R, Doust RH, Kachuei R, Mortazavi SM, Khoobdel M, Ahamadi A. Simultaneous detection and differentiates of Brucella abortus and Brucella melitensis by combinatorial PCR. Asian Pac J Trop Med. 2012;5(1):24-8. [DOI:10.1016/S1995-7645(11)60239-3]
29. Piranfar V, Sharif M, Hashemi M, Vahdati AR, Mirnejad R. Detection and discrimination of two Brucella species by multiplex real-time PCR and high-resolution melt analysis curve from human blood and comparison of results using RFLP. Iranian journal of basic medical sciences. 2015;18(9):909.
30. Gee JE, De BK, Levett PN, Whitney AM, Novak RT, Popovic T. Use of 16S rRNA gene sequencing for rapid confirmatory identification of Brucella isolates. J Clin Microbiol. 2004;42(8):3649-54. [DOI:10.1128/JCM.42.8.3649-3654.2004] [PMID] [PMCID]
31. Sayan M, Yumuk Z, Dündar D, Bilenoğlu O, Erdenliğ S, Yaşvar E, et al. Rifampicin resistance phenotyping of Brucella melitensis by rpoB gene analysis in clinical isolates. J Chemother. 2008;20(4):431-5. [DOI:10.1179/joc.2008.20.4.431] [PMID]
32. Ogier J-C, Pages S, Galan M, Barret M, Gaudriault S. rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencing. BMC Microbiol. 2019;19(1):171. [DOI:10.1186/s12866-019-1546-z] [PMID] [PMCID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | Iranian Journal of Medical Microbiology

Designed & Developed by : Yektaweb | Publisher: Farname Inc